Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of Soybean Elongation Factor Family in Resistance to Soybean Mosaic Virus

A soybean mosaic virus and elongation factor technology, which can be used in applications, angiosperms/flowering plants, genetic engineering, etc., and can solve the problem of undisclosed gene functions.

Active Publication Date: 2018-08-07
NANJING AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Although the soybean genome was sequenced as early as 2010, the functions of each gene in it have not been made public

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Soybean Elongation Factor Family in Resistance to Soybean Mosaic Virus
  • Application of Soybean Elongation Factor Family in Resistance to Soybean Mosaic Virus
  • Application of Soybean Elongation Factor Family in Resistance to Soybean Mosaic Virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Construction of yeast two-hybrid library and screening of host factors interacting with P3

[0045] Using the RNA of Nannong 1138-2 inoculated with the virulent SMV strain SC15 as material, a three-frame yeast two-hybrid cDNA library with pPR3 as the terminal vector was constructed. Use the library identification primer upstream primer: 5'GTCGAAAATTCAAGACAAGG3' and downstream primer: 5'AAGCGTGACATAACTAATTAC 3' to identify the quality of the library by colony PCR. The procedure is as follows:

[0046]

[0047] The PCR product was detected by 1% agarose gel electrophoresis, and the quality identification of the yeast two-hybrid library was found ( figure 1 ), the library capacity is 0.68×10 7 ; Randomly picked 32 clones, PCR showed that the insert fragment of the library was between 800bp and 4.5kb, and the recombination rate of the library was as high as 94%. The results of library capacity and insert fragments showed that the quality of the library was hi...

Embodiment 2

[0065] Example 2 Functional verification of elongation factor family genes based on BPMV silencing system

[0066] The results of two-dimensional electrophoresis of existing proteins in our laboratory showed that GmEF1b was up-regulated in disease-resistant varieties. Members of the elongation factor family often exist and function in the form of complexes, so GmEF1b is also the focus of further functional analysis.

[0067] 2.1 Subcellular localization and colocalization studies

[0068] The vector containing the target gene was heat-shock transformed into Agrobacterium, and the positive Agrobacterium liquid was injected into the red fluorescent protein (Red Flourescent Protein, RFP) nucleus-localized transgenic Nicotiana benthamiana and RFP endoplasmic reticulum-localized transgenic Nicotiana benthamiana with a syringe, Transient expression of the target gene in tobacco leaf cells. Concrete steps are with embodiment 1. The injected tobacco is cultured in a light incubator...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of soybean elongation factor family in resisting soybean mosaic virus. Soybean elongation factors GmEF1a and GmEF1b can be used in regulating soybean resistance to soybean mosaic virus through endoplasmic reticulum stress. SMV replication occurs in the endoplasmic reticulum, which requires the participation of GmEF1a and GmEF1b. The accumulation of SMV causes endoplasmic reticulum stress response, and silencing GmEF1a and GmEF1b will reduce the endoplasmic reticulum stress response, and the plants will be more resistant to disease. It can be seen that the GmEF1a gene and the GmEF1b gene of the silent elongation factor family can be used to construct transgenic plants resistant to SMV virus. And because these two genes are derived from soybeans, the safety of genetically modified soybeans is further improved.

Description

technical field [0001] The invention belongs to the field of soybean genetic engineering and relates to the application of soybean elongation factor family in resisting soybean mosaic virus. Background technique [0002] Soybean mosaic virus (SMV) is one of the viruses that have the greatest impact on soybean production. Soybean production areas around the world are affected by SMV to varying degrees. When the disease occurs, soybean yield and grain appearance are affected. SMV is a single-stranded positive-sense RNA containing an open reading frame, which is transcribed to produce a polypeptide, which is cleaved into 11 mature proteins by its own protein. Among them, at least three proteins have been identified that have important effects on the toxicity of SMV and the range of host infection, and P3 is one of them. [0003] Although the soybean genome was sequenced as early as 2010, the functions of each gene in it have not been made public. If the genes related to the r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82C12N15/29A01H5/00A01H6/54
Inventor 栾鹤翔智海剑
Owner NANJING AGRICULTURAL UNIVERSITY