Application of Soybean Elongation Factor Family in Resistance to Soybean Mosaic Virus
A soybean mosaic virus and elongation factor technology, which can be used in applications, angiosperms/flowering plants, genetic engineering, etc., and can solve the problem of undisclosed gene functions.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1 Construction of yeast two-hybrid library and screening of host factors interacting with P3
[0045] Using the RNA of Nannong 1138-2 inoculated with the virulent SMV strain SC15 as material, a three-frame yeast two-hybrid cDNA library with pPR3 as the terminal vector was constructed. Use the library identification primer upstream primer: 5'GTCGAAAATTCAAGACAAGG3' and downstream primer: 5'AAGCGTGACATAACTAATTAC 3' to identify the quality of the library by colony PCR. The procedure is as follows:
[0046]
[0047] The PCR product was detected by 1% agarose gel electrophoresis, and the quality identification of the yeast two-hybrid library was found ( figure 1 ), the library capacity is 0.68×10 7 ; Randomly picked 32 clones, PCR showed that the insert fragment of the library was between 800bp and 4.5kb, and the recombination rate of the library was as high as 94%. The results of library capacity and insert fragments showed that the quality of the library was hi...
Embodiment 2
[0065] Example 2 Functional verification of elongation factor family genes based on BPMV silencing system
[0066] The results of two-dimensional electrophoresis of existing proteins in our laboratory showed that GmEF1b was up-regulated in disease-resistant varieties. Members of the elongation factor family often exist and function in the form of complexes, so GmEF1b is also the focus of further functional analysis.
[0067] 2.1 Subcellular localization and colocalization studies
[0068] The vector containing the target gene was heat-shock transformed into Agrobacterium, and the positive Agrobacterium liquid was injected into the red fluorescent protein (Red Flourescent Protein, RFP) nucleus-localized transgenic Nicotiana benthamiana and RFP endoplasmic reticulum-localized transgenic Nicotiana benthamiana with a syringe, Transient expression of the target gene in tobacco leaf cells. Concrete steps are with embodiment 1. The injected tobacco is cultured in a light incubator...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



