Unlock instant, AI-driven research and patent intelligence for your innovation.

Chimeric antigen receptor and gene and recombinant expression vector thereof, engineered CD19 targeting NKT cell and application thereof

A chimeric antigen receptor and NKT cell technology, which is applied in the field of tumor biological products, can solve the problems of non-specific killing of target cells, the need to improve specific killing activity, and restrict targeted therapy of malignant tumors, etc., to achieve enhanced specific killing activity, Good industrial application prospect, good tolerance effect

Inactive Publication Date: 2016-03-09
GENERAL HOSPITAL OF PLA
View PDF3 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, in the process of antibody-dependent cell-mediated killing, since the antibody can specifically bind to the corresponding epitope on the target cell, NKT cells can kill any target cell that has been bound to the antibody, so the antibody and the target cell Antigen binding is specific, but the killing effect of NKT cells on target cells is non-specific
In addition, under normal circumstances, the half-life of infused NKT cells in the patient's body is about 2 weeks, and the validity period is short, requiring repeated infusions
In addition, NKT cells themselves lack specific antibodies, which are not enough to enrich around tumors or in tumor nests, which restricts the targeted treatment of malignant tumors by NKT cells
Moreover, studies have shown that NKT cells do not have a killing effect on all tumors, and the killing effect on some tumors is relatively weak, and the specific killing activity needs to be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric antigen receptor and gene and recombinant expression vector thereof, engineered CD19 targeting NKT cell and application thereof
  • Chimeric antigen receptor and gene and recombinant expression vector thereof, engineered CD19 targeting NKT cell and application thereof
  • Chimeric antigen receptor and gene and recombinant expression vector thereof, engineered CD19 targeting NKT cell and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0027] The preparation method of the lentiviral expression vector pWPT-CD19ScFv-2-CD8-CD137-CD3ζ is not particularly limited, and can be various methods that those skilled in the art can think of. Preferably, the lentiviral expression vector pWPT-CD19ScFv-2 The preparation method of -CD8-CD137-CD3ζ includes the following steps:

[0028] (1) Amplify the hinge region and transmembrane region of CD8, the intracellular signal domain of CD137 and the intracellular signal domain of CD3ζ from NKT cell cDNA, and clone them into the vector pWPT-GFP to construct pWPT-CD8 -CD137-CD3ζ;

[0029] (2) The nucleotide sequence encoding rat growth hormone signal peptide and CD19ScFv-2 was synthesized and cloned into pWPT-CD8-CD137-CD3ζ. After sequencing and verification, the correct sequence of pWPT-CD19ScFv-2-CD8-CD137 was obtained -CD3ζ.

[0030] In step (1), there is no particular limitation on the method of amplifying the hinge region and transmembrane region of CD8, the intracellular signal dom...

Embodiment 1

[0065] Example 1 Preparation of NKT cells

[0066] (1) Take human venous blood in a vacuum tube containing heparin. Using lymphocyte separation fluid, mononuclear cells (PBMCs) were obtained by density gradient centrifugation.

[0067] (2) After washing PBMCs three times, use NKT cell culture medium GT-T551 containing 0.6% by volume of human autologous serum to adjust the final cell concentration to 2×10 6 Cells / mL; inoculate the cells in 75cm coated with retronectin at a final concentration of 10μg / mL 2 Cell culture flask. Then add the final concentration of 500U / mL recombinant human interleukin 2, 50ng / ml CD3 monoclonal antibody and 50ng / mL recombinant human interleukin-15 to the culture medium, at 37℃, saturated humidity of 5% CO 2 Cultivate in an incubator.

[0068] (3) On the 4th day of culture, transfer the cells to an uncoated culture flask, and add NKT cell culture medium GT-T551 according to the number of cell growth every 2 days, and control the cell concentration to 1×10 ...

Embodiment 2

[0069] Example 2 Construction of lentiviral expression vector pWPT-CD19ScFv-2-CD8-CD137-CD3ζ

[0070] (1) Preparation of NKT cell cDNA

[0071] Centrifuge the NKT cells cultured in Example 1, extract the total RNA of the cells with a total RNA extraction kit RNAisoReagent, and store them at -80°C for later use. RevertAid, a reverse transcription kit for extracted total RNA TM FirstStrandcDNASynthesisKit reverse transcribed NKT cell cDNA, stored at -20℃ for later use.

[0072] (2) Preparation of lentiviral plasmid pWPT-CD8-CD137-CD3ζ

[0073] Design and synthesize the following primer sequences (wherein, the underlined mark is the protective base, and the box is the restriction site):

[0074] P1 (SEQIDNO.11): GATC CTGAGCAACTCCATCATGTACTTC

[0075] MluI

[0076] P2(SEQIDNO.12): GATC GCAGTAAAGGGTGATAACCAGTGA

[0077] BglII

[0078] P3(SEQIDNO.13): GATC AAACGGGGCAGAAAGAAACTCC

[0079] BglII

[0080] P4 (SEQIDNO.14): GATC CAGTTCACATCCTCCTTCTTCTTCT

[0081] EcoRI

[0082] P5 (SEQIDNO.1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a chimeric antigen receptor and a gene and a recombinant expression vector thereof, an engineered CD19 targeted NKT cell and an application thereof. The chimeric antigen receptor is CD19ScFv-2-CD8-CD137-CD3zeta which is formed by connecting CD19ScFv-2, a hinge domain and a transmembrane domain of CD8, an intracellular signal structural domain of CD137 and an intracellular signal structural domain of CD3zeta in series. The nucleotide sequence, which encodes the gene of the CD19ScFv-2, is represented by SEQ ID NO.7. By adopting the chimeric antigen receptor CD19ScFv-2-CD8-CD137-CD3zeta modified NKT cell for treating CD19 positive acute b lymphoblastic leukemia, the cell has specific killing activity on leukemia cells.

Description

Technical field [0001] The present invention belongs to the field of tumor biological products, in particular, it relates to a chimeric antigen receptor CD19ScFv-2-CD8-CD137-CD3ζ and its gene and recombinant expression vector in adoptive immunotherapy, and engineered CD19 targeting NKT cells (CAR19-2-NKT cells) and its applications. Background technique [0002] Natural killer cells (NKT) are a special type of T lymphocyte subgroup with dual properties of T cells and NK cells. NKT cells can express TCR of T cells and NKR-P1 of NK cells. Under the mediation of TCR and NKR, NKT cells can produce a large amount of IL-4 and INFγ, which can kill tumor cells. NKT cells bind to the Fc segment of specific antibodies through CD16 on their surface, and exert ADCC (antibody-dependent cell-mediated cytotoxicity) effects. However, in the process of antibody-dependent cell-mediated killing, since the antibody can specifically bind to the corresponding epitope on the target cell, NKT cells ca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/867C12N5/10A61K48/00A61K38/17A61K35/17A61P35/02
Inventor 韩庆旺韩为东王晓慧王瑶郭业磊付小兵
Owner GENERAL HOSPITAL OF PLA