Quick-acting insulin aspart precursor protein and preparation method for quick-acting insulin
A technology of insulin aspart and its precursor, which is applied in the field of rapid-acting insulin precursor protein, can solve the problems of increasing the risk of immune response, low insulin expression, high glycosylation, etc., to increase the content of impurities, less impurities, The effect of increasing the amount of expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1 Construction of the recombinant plasmid pPIC9K-N-B(1-29)-C-A(1-21) containing the insulin aspart precursor gene
[0037] According to the amino acid sequence of the insulin aspart precursor, the corresponding cDNA sequence was designed, and then the sequence was optimized in terms of codon bias, GC content, codon adaptation index CAI, hairpin structure and cis-acting elements, and then the C-terminus of the sequence was The stop codon TAA was added, the restriction enzyme XhoI sequence CTCGAG was added to the 5' end, and the restriction enzyme NotI sequence GCGGCCGC was added to the 3' end to obtain the insulin aspart precursor coding gene. Entrusted Suzhou Shengxin Biotechnology Co., Ltd. to carry out the whole gene synthesis. Insert the synthetic gene into the pUC57 plasmid digested by the restriction enzyme EcoRV to obtain the cloning plasmid pUC57-N-B(1-29)-C-A(1-21) (wherein N represents the N-segment leader peptide sequence Z1(XY)nZ2Z3Z4, and C represent...
Embodiment 2
[0040] Example 2 Constructing the recombinant plasmid pPICZαA-N-B(1-29)-C-A(1-21) containing the insulin aspart precursor gene
[0041] The cloned plasmid pUC57-N-B(1-29)-C-A(1-21) was digested with restriction enzymes XhoI and NotI, the gene fragment was recovered, connected to the plasmid pPICZαA digested with XhoI and NotI, transformed into Escherichia coli TOP10, and the resistant The ampicillin-affected transformants were sequenced with the sequencing primer 5'gactggttccaattgacaagc, and the transformants with no gene mutation and correct reading frame were selected to obtain the recombinant expression plasmid pPICZαA-N-B(1-29)-C-A(1-21) .
[0042] figure 2 The structure of the recombinant expression plasmid pPICZαA-N-B(1-29)-C-A(1-21) containing the insulin aspart precursor gene is shown. GOI stands for insulin aspart precursor gene, α-Factorsecretionsignal stands for α mating factor signal peptide, AOX1promoter stands for AO1 promoter, AOX1TT stands for AOX1 terminato...
Embodiment 3
[0043] Example 3 Constructing the recombinant plasmid pPinkαHC-N-B(1-29)-C-A(1-21) containing the insulin aspart precursor gene
[0044] Take 5'tcgcgaatgcatctagat gagtcttgac (wherein gagtcttgac is restriction enzyme MlyI recognition sequence) and 5' acgggcccgggatccgat ggtacc (wherein ggtacc is the restriction enzyme KpnI recognition sequence) as a primer, with the cloning plasmid pUC57-N-B(1-29)-C-A(1-21) as a template, PCR amplifies the insulin aspart precursor gene fragment, connects to KpnI-digested plasmid pPinkα-HC, transformant Escherichia coli TOP10, and ampicillin-resistant transformants were sequenced with the sequencing primer 5'gactggttccaattgacaagc, and the transformants without gene mutation and correct reading frame were selected to obtain recombinant Expression plasmid pPinkαHC-N-B(1-29)-C-A(1-21).
[0045] image 3 The structure of the recombinant expression plasmid pPinkαHC-N-B(1-29)-C-A(1-21) containing the insulin aspart precursor gene is shown. Among ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
