Quick-acting insulin aspart precursor protein and preparation method for quick-acting insulin

A technology of insulin aspart and its precursor, which is applied in the field of rapid-acting insulin precursor protein, can solve the problems of increasing the risk of immune response, low insulin expression, high glycosylation, etc., to increase the content of impurities, less impurities, The effect of increasing the amount of expression

Inactive Publication Date: 2016-03-23
ZHUHAI JINBAIKANG BIOLOGICAL TECH CO LTD
View PDF6 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although Saccharomyces cerevisiae can secrete proteins outside the cell, there are also some disadvantages: Saccharomyces cerevisiae is prone to highly glycosylated expression products, which increases the risk of immune reactions in the human body, so it is necessary to add steps to control impurities in the drug purification process content
[0010] However, the current scheme of using the Pichia pastoris expression system to produce insulin still faces the challenge of low expression and low yield. The reasons involve many aspects such as coding sequence and purification method.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Quick-acting insulin aspart precursor protein and preparation method for quick-acting insulin
  • Quick-acting insulin aspart precursor protein and preparation method for quick-acting insulin
  • Quick-acting insulin aspart precursor protein and preparation method for quick-acting insulin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 Construction of the recombinant plasmid pPIC9K-N-B(1-29)-C-A(1-21) containing the insulin aspart precursor gene

[0037] According to the amino acid sequence of the insulin aspart precursor, the corresponding cDNA sequence was designed, and then the sequence was optimized in terms of codon bias, GC content, codon adaptation index CAI, hairpin structure and cis-acting elements, and then the C-terminus of the sequence was The stop codon TAA was added, the restriction enzyme XhoI sequence CTCGAG was added to the 5' end, and the restriction enzyme NotI sequence GCGGCCGC was added to the 3' end to obtain the insulin aspart precursor coding gene. Entrusted Suzhou Shengxin Biotechnology Co., Ltd. to carry out the whole gene synthesis. Insert the synthetic gene into the pUC57 plasmid digested by the restriction enzyme EcoRV to obtain the cloning plasmid pUC57-N-B(1-29)-C-A(1-21) (wherein N represents the N-segment leader peptide sequence Z1(XY)nZ2Z3Z4, and C represent...

Embodiment 2

[0040] Example 2 Constructing the recombinant plasmid pPICZαA-N-B(1-29)-C-A(1-21) containing the insulin aspart precursor gene

[0041] The cloned plasmid pUC57-N-B(1-29)-C-A(1-21) was digested with restriction enzymes XhoI and NotI, the gene fragment was recovered, connected to the plasmid pPICZαA digested with XhoI and NotI, transformed into Escherichia coli TOP10, and the resistant The ampicillin-affected transformants were sequenced with the sequencing primer 5'gactggttccaattgacaagc, and the transformants with no gene mutation and correct reading frame were selected to obtain the recombinant expression plasmid pPICZαA-N-B(1-29)-C-A(1-21) .

[0042] figure 2 The structure of the recombinant expression plasmid pPICZαA-N-B(1-29)-C-A(1-21) containing the insulin aspart precursor gene is shown. GOI stands for insulin aspart precursor gene, α-Factorsecretionsignal stands for α mating factor signal peptide, AOX1promoter stands for AO1 promoter, AOX1TT stands for AOX1 terminato...

Embodiment 3

[0043] Example 3 Constructing the recombinant plasmid pPinkαHC-N-B(1-29)-C-A(1-21) containing the insulin aspart precursor gene

[0044] Take 5'tcgcgaatgcatctagat gagtcttgac (wherein gagtcttgac is restriction enzyme MlyI recognition sequence) and 5' acgggcccgggatccgat ggtacc (wherein ggtacc is the restriction enzyme KpnI recognition sequence) as a primer, with the cloning plasmid pUC57-N-B(1-29)-C-A(1-21) as a template, PCR amplifies the insulin aspart precursor gene fragment, connects to KpnI-digested plasmid pPinkα-HC, transformant Escherichia coli TOP10, and ampicillin-resistant transformants were sequenced with the sequencing primer 5'gactggttccaattgacaagc, and the transformants without gene mutation and correct reading frame were selected to obtain recombinant Expression plasmid pPinkαHC-N-B(1-29)-C-A(1-21).

[0045] image 3 The structure of the recombinant expression plasmid pPinkαHC-N-B(1-29)-C-A(1-21) containing the insulin aspart precursor gene is shown. Among ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an insulin aspart precursor. The amino acid sequence is Z1(XY)nZ2Z3Z4-B(1-29)-C1C2C3-A(1-21), wherein Z1, X and Z2 are Asp or Glu respectively, Y is Ala or Gly, n is an integer from 1-10, Z3 is Pro, Glu or Asp, Z4 and C3 are Lys or Arg respectively, C1 and C2 are Glu, Asp, Ala or Gly respectively, B(1-29) is insulin aspart B chain 1-29 bit amino acid, and A(1-21) is insulin aspart A chain 1-21 bit amino acid. The invention also provides a coding gene, a cloning vector or an expression vector containing the coding gene, a transformant, and a method for preparing quick-acting insulin by utilization of the quick-acting insulin aspart precursor protein. The expression level of the product is high, the fermentation expression product purity is high, the extraction method is simple and the yield is high.

Description

technical field [0001] The invention relates to a fast-acting insulin precursor protein, its coding gene, a cloning vector or an expression vector containing the coding gene, a transformant, and a method for preparing fast-acting insulin by using the fast-acting insulin precursor protein. Background technique [0002] According to the latest statistics from the International Diabetes Federation (IDF), the number of diabetics in the world has reached 387 million in 2014. According to the current growth rate, it is predicted that nearly 592 million people will suffer from diabetes in the world by 2035. What is worrying is that the number of diabetic patients in China is as high as 96.288 million, which is the country with the largest number of diabetic patients in the world. [0003] Rapid-acting insulins including insulin aspart and insulin lispro belong to the third-generation insulins and can be used for the treatment of type 1 diabetes and type 2 diabetes in adults. Insul...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/62C12N15/17C12N15/81C12N1/19C12R1/84
CPCC07K14/62
Inventor赖红星肖拥军马文柱罗湘冀夏玉平祝捷陈武光
OwnerZHUHAI JINBAIKANG BIOLOGICAL TECH CO LTD