Supercharge Your Innovation With Domain-Expert AI Agents!

A kind of cell model and screening method for screening CCR4 antagonists

A screening method and technology for antagonists, applied in the field of medicine and cell biology, can solve the problems of difficulty, low safety, and small test window of antagonists

Active Publication Date: 2019-11-22
INST OF PHARMACOLOGY & TOXICOLOGY ACAD OF MILITARY MEDICAL SCI P L A
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this analytical method requires specific filtration devices and steps to separate free and bound [ 35 S]GTPγS, which limits the throughput of this analytical method. In addition, it is worth noting that this analytical method involves radioactive substances, which is less safe and is not the direction of future development.
[0006] Screening for agonists or antagonists of Gαs-coupled receptors by cAMP analysis is usually easy, but screening for ligands, especially antagonists, of Gαi-coupled receptors such as CCR4 is more difficult
Without being bound by theory, one reason for this is the need to pre-stimulate the activation of AC with forskolin (forskolin, a direct activator of adenylyl cyclase), and then use a receptor agonist (TARC or MDC) to inhibit activation by forskolin. AC, and then to detect the opposite effect of antagonists and agonists, more optimization steps are required, and the test window is relatively small
[0007] In addition, there are CCR4-HEk293 cell line (Qi, H., et al., An antagonist for CCR4 alleviates murine allergic rhinitis by intranasal administration. Int ArchAllergy Immunol, 2012.159(3): p.297-305) Hut78 cell line (Sato, T., et al., Inhibitory effect of the new orally active CCR4 antagonist K327on CCR4+CD4+T cell migration into the lung of mice with ovalbumin-induced lung allergic inflammation. Pharmacology, 2009.84(3):p.171-82) cell chemotaxis Experiment, but this method is complicated and not suitable for high-throughput

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of cell model and screening method for screening CCR4 antagonists
  • A kind of cell model and screening method for screening CCR4 antagonists
  • A kind of cell model and screening method for screening CCR4 antagonists

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0097] Example 1: Establishment of a cell line stably expressing human CCR4 (human osteosarcoma cell line CCR4-EGFP_U2OS-4-G4)

[0098] 1. Construct the pCORONneo-CCR4-EGFPn eukaryotic expression vector containing the full-length cDNA of human CCR4.

[0099] The construction of the vector can refer to the following steps:

[0100] Using the obtained full-length cDNA sequence of human CCR4 as a template, PCR amplification was performed with the following primers 1-2.

[0101] The full-length cDNA sequence of CCR4 (SEQ ID NO: 9, corresponding to GenBank accession number: NM_005508.4) is as follows:

[0102] AGCTGCTTCTGGTTGGGCCCAGACCTGCCTTGAGGAGCCTGTAGAGTTAAAAAATGAACCCCACGGATATAGCAGACACCACCCTCGATGAAAGCATATACAGCAATTACTATCTGTATGAAAGTATCCCCAAGCCTTGCACCAAAGAAGGCATCAAGGCATTTGGGGAGCTCTTCCTGCCCCCACTGTATTCCTTGGTTTTTGTATTTGGTCTGCTTGGAAATTCTGTGGTGGTTCTGGTCCTGTTCAAATACAAGCGGCTCAGGTCCATGACTGATGTGTACCTGCTCAACCTTGCCATCTCGGATCTGCTCTTCGTGTTTTCCCTCCCTTTTTGGGGCTACTATGCAGCAGACCAGTGGGTTTTTGGGCTAGGT...

Embodiment 2

[0120] Example 2: Identification of newly established cell lines

[0121] The human osteosarcoma cell line CCR4-EGFP_U2OS-4-G4 established in Example 1 was used.

[0122]Chemokines TARC and MDC were used to activate CCR4, which promoted the redistribution of CCR4-EGFP green fluorescence and induced the formation of green fluorescent particles.

[0123] After CCR4 in the established cell line is combined with its specific ligands TARC and MDC, after activation, CCR4-EGFP is internalized and aggregated and distributed to endosomes, forming green fluorescent particles that can be dynamically traced under a fluorescence microscope.

[0124] In order to quantitatively detect the area of ​​green fluorescent particle formation of CCR4-EGFP induced by TARC and MDC, the present invention uses InCell Analyzer1000 or In Cell Analyzer2000 to obtain the cell image of CCR4-EGFP, and uses (IN CellAnalyzer1000Granularity Analysis Module) to analyze the particle formation, expressed as parti...

Embodiment 3

[0133] Example 3: Determination of the half effective concentration of TARC-induced CCR4-EGFP granule formation area

[0134] The human osteosarcoma cell line CCR4-EGFP_U2OS-4-G4 established in Example 1 was used.

[0135] 1. Make cells into 8×10 4 cells / mL of cell suspension, inoculated in a black transparent bottom 96-well culture plate, 100 μL / well.

[0136] 2. At 37°C, 5% CO 2 , 80% humidity incubator for 24 hours.

[0137] 3. Wash the cells twice with cell analysis solution, 100 μL / well each time; discard the solution, and then add 50 μL / well of cell analysis solution.

[0138] 4. Add TARC and MDC diluted in the cell analysis solution to make the final concentrations respectively 0.001, 0.003, 0.01, 0.03, 0.1, 0.3, 0.6, and 1 μg / mL.

[0139] 5. 37°C, 5% CO 2 After incubating in an 80% humidity incubator for 20 minutes, add 37°C preheated cell fixation solution, 100 μL / well, shake the culture plate slightly to mix, and place it at room temperature in the dark for 20...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention belongs to the field of pharmacy and cell biology, and relates to an efficient and reliable high content CCR4 antagonist screening cell model using human chemokine receptor 4 as a target, and a screening method thereof. According to the present invention, a cell line being subjected to human CCR4-enhanced green fluorescent protein fusion expression introducing is established, excitation is performed through human thymus activation regulated chemokine and human macrophage chemotatic factor, the CCR4 with green fluorescent protein is induced to produce re-distribution so as to form green fluorescent particles, and the CCR4 antagonist screening cell model for high-content screening is established; the bioactivity of the compound is evaluated by determining the CCR4 green fluorescent particle formation excited or inhibited by the screened compound through the model; and the established drug screening model is the sensitive, efficient and reliable CCR4 antagonist screening cell model suitable for high-throughput and high-content screening, and the method is the sensitive, efficient and reliable method suitable for high-throughput and high-content screening.

Description

technical field [0001] The invention belongs to the field of medicine and cell biology, and relates to a high-throughput screening cell model of CCR4 antagonists and its establishment method and application, in particular to a CCR4-based high-content screening CCR4 antagonist cell model and its establishment method and application. Background technique [0002] Drug screening models are an essential platform for drug activity research in drug development. High-content analysis technology can simultaneously detect the influence of the tested sample on cell morphology, growth, differentiation, migration, apoptosis, metabolic pathway and signal transduction under the premise of maintaining the integrity of cell structure and function. At the same time, it is possible to observe the relevant toxicity information of the test sample. Therefore, the introduction of high-content screening technology is the trend of innovative drug screening research. [0003] CCR4 (chemokine recep...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N5/10C12Q1/02
Inventor 王莉莉李微戴文婕龙隆肖军海陈伟李松
Owner INST OF PHARMACOLOGY & TOXICOLOGY ACAD OF MILITARY MEDICAL SCI P L A
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com