A kind of cell model and screening method for screening CCR4 antagonists
A screening method and technology for antagonists, applied in the field of medicine and cell biology, can solve the problems of difficulty, low safety, and small test window of antagonists
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0097] Example 1: Establishment of a cell line stably expressing human CCR4 (human osteosarcoma cell line CCR4-EGFP_U2OS-4-G4)
[0098] 1. Construct the pCORONneo-CCR4-EGFPn eukaryotic expression vector containing the full-length cDNA of human CCR4.
[0099] The construction of the vector can refer to the following steps:
[0100] Using the obtained full-length cDNA sequence of human CCR4 as a template, PCR amplification was performed with the following primers 1-2.
[0101] The full-length cDNA sequence of CCR4 (SEQ ID NO: 9, corresponding to GenBank accession number: NM_005508.4) is as follows:
[0102] AGCTGCTTCTGGTTGGGCCCAGACCTGCCTTGAGGAGCCTGTAGAGTTAAAAAATGAACCCCACGGATATAGCAGACACCACCCTCGATGAAAGCATATACAGCAATTACTATCTGTATGAAAGTATCCCCAAGCCTTGCACCAAAGAAGGCATCAAGGCATTTGGGGAGCTCTTCCTGCCCCCACTGTATTCCTTGGTTTTTGTATTTGGTCTGCTTGGAAATTCTGTGGTGGTTCTGGTCCTGTTCAAATACAAGCGGCTCAGGTCCATGACTGATGTGTACCTGCTCAACCTTGCCATCTCGGATCTGCTCTTCGTGTTTTCCCTCCCTTTTTGGGGCTACTATGCAGCAGACCAGTGGGTTTTTGGGCTAGGT...
Embodiment 2
[0120] Example 2: Identification of newly established cell lines
[0121] The human osteosarcoma cell line CCR4-EGFP_U2OS-4-G4 established in Example 1 was used.
[0122]Chemokines TARC and MDC were used to activate CCR4, which promoted the redistribution of CCR4-EGFP green fluorescence and induced the formation of green fluorescent particles.
[0123] After CCR4 in the established cell line is combined with its specific ligands TARC and MDC, after activation, CCR4-EGFP is internalized and aggregated and distributed to endosomes, forming green fluorescent particles that can be dynamically traced under a fluorescence microscope.
[0124] In order to quantitatively detect the area of green fluorescent particle formation of CCR4-EGFP induced by TARC and MDC, the present invention uses InCell Analyzer1000 or In Cell Analyzer2000 to obtain the cell image of CCR4-EGFP, and uses (IN CellAnalyzer1000Granularity Analysis Module) to analyze the particle formation, expressed as parti...
Embodiment 3
[0133] Example 3: Determination of the half effective concentration of TARC-induced CCR4-EGFP granule formation area
[0134] The human osteosarcoma cell line CCR4-EGFP_U2OS-4-G4 established in Example 1 was used.
[0135] 1. Make cells into 8×10 4 cells / mL of cell suspension, inoculated in a black transparent bottom 96-well culture plate, 100 μL / well.
[0136] 2. At 37°C, 5% CO 2 , 80% humidity incubator for 24 hours.
[0137] 3. Wash the cells twice with cell analysis solution, 100 μL / well each time; discard the solution, and then add 50 μL / well of cell analysis solution.
[0138] 4. Add TARC and MDC diluted in the cell analysis solution to make the final concentrations respectively 0.001, 0.003, 0.01, 0.03, 0.1, 0.3, 0.6, and 1 μg / mL.
[0139] 5. 37°C, 5% CO 2 After incubating in an 80% humidity incubator for 20 minutes, add 37°C preheated cell fixation solution, 100 μL / well, shake the culture plate slightly to mix, and place it at room temperature in the dark for 20...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


