A kind of cell model and screening method for screening CCR4 antagonists
A screening method and technology for antagonists, applied in the field of medicine and cell biology, can solve the problems of difficulty, low safety, and small test window of antagonists
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0097] Example 1: Establishment of a cell line stably expressing human CCR4 (human osteosarcoma cell line CCR4-EGFP_U2OS-4-G4)
[0098] 1. Construct the pCORONneo-CCR4-EGFPn eukaryotic expression vector containing the full-length cDNA of human CCR4.
[0099] The construction of the vector can refer to the following steps:
[0100] Using the obtained full-length cDNA sequence of human CCR4 as a template, PCR amplification was performed with the following primers 1-2.
[0101] The full-length cDNA sequence of CCR4 (SEQ ID NO: 9, corresponding to GenBank accession number: NM_005508.4) is as follows:
[0102] AGCTGCTTCTGGTTGGGCCCAGACCTGCCTTGAGGAGCCTGTAGAGTTAAAAAATGAACCCCACGGATATAGCAGACACCACCCTCGATGAAAGCATATACAGCAATTACTATCTGTATGAAAGTATCCCCAAGCCTTGCACCAAAGAAGGCATCAAGGCATTTGGGGAGCTCTTCCTGCCCCCACTGTATTCCTTGGTTTTTGTATTTGGTCTGCTTGGAAATTCTGTGGTGGTTCTGGTCCTGTTCAAATACAAGCGGCTCAGGTCCATGACTGATGTGTACCTGCTCAACCTTGCCATCTCGGATCTGCTCTTCGTGTTTTCCCTCCCTTTTTGGGGCTACTATGCAGCAGACCAGTGGGTTTTTGGGCTAGGT...
Embodiment 2
[0120] Example 2: Identification of newly established cell lines
[0121] The human osteosarcoma cell line CCR4-EGFP_U2OS-4-G4 established in Example 1 was used.
[0122]Chemokines TARC and MDC were used to activate CCR4, which promoted the redistribution of CCR4-EGFP green fluorescence and induced the formation of green fluorescent particles.
[0123] After CCR4 in the established cell line is combined with its specific ligands TARC and MDC, after activation, CCR4-EGFP is internalized and aggregated and distributed to endosomes, forming green fluorescent particles that can be dynamically traced under a fluorescence microscope.
[0124] In order to quantitatively detect the area of green fluorescent particle formation of CCR4-EGFP induced by TARC and MDC, the present invention uses InCell Analyzer1000 or In Cell Analyzer2000 to obtain the cell image of CCR4-EGFP, and uses (IN CellAnalyzer1000Granularity Analysis Module) to analyze the particle formation, expressed as parti...
Embodiment 3
[0133] Example 3: Determination of the half effective concentration of TARC-induced CCR4-EGFP granule formation area
[0134] The human osteosarcoma cell line CCR4-EGFP_U2OS-4-G4 established in Example 1 was used.
[0135] 1. Make cells into 8×10 4 cells / mL of cell suspension, inoculated in a black transparent bottom 96-well culture plate, 100 μL / well.
[0136] 2. At 37°C, 5% CO 2 , 80% humidity incubator for 24 hours.
[0137] 3. Wash the cells twice with cell analysis solution, 100 μL / well each time; discard the solution, and then add 50 μL / well of cell analysis solution.
[0138] 4. Add TARC and MDC diluted in the cell analysis solution to make the final concentrations respectively 0.001, 0.003, 0.01, 0.03, 0.1, 0.3, 0.6, and 1 μg / mL.
[0139] 5. 37°C, 5% CO 2 After incubating in an 80% humidity incubator for 20 minutes, add 37°C preheated cell fixation solution, 100 μL / well, shake the culture plate slightly to mix, and place it at room temperature in the dark for 20...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com