Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

340results about How to "Good experimental repeatability" patented technology

Subway disaster accident simulation testing platform

The experiment platform includes experimental solid model of underground in 1:5 large scale, fire source system, ventilation and smoke extraction system, fire detection alarm system, experimental measurement and collection system, and data analytic system. Structure of multistory building of the solid model includes interzone tunnels, platforms, station halls and facility rooms etc. Modularized design is adopted. Fire source system can simulate different scenes of fire, and generate hot smoke gas of fire nigh true. Power and fuming quantity of the fire source system is determined based on theoretical analysis from model similitude. The experiment platform can generate growth curve of different power of fire. The experiment platform is in use for carrying out experimental studies: happening and growing mechanism of fire, and poison gas outspread inside stations of underground as well as control technique. The invention is applicable to different structures of station.
Owner:CHINA ACAD OF SAFETY SCI & TECH

Subway station fire hazard simulation experiment platform

The invention relates to a subway station fire hazard simulation experiment platform, provides a subway station interior fire hazard simulation experiment platform and relates to subway fire hazard accident simulation equipment which is used to carry out experiment research on a generation and development mechanism of the subway station fire hazard accident, a control, prevention and treatment technology. The platform comprises a large-scale subway station entity model, a fire source system, a ventilation and smoke exhaust system, a fire hazard detection alarm system, a experiment measurement acquisition system and a data analysis system. The large-scale subway station entity model is made of a fireproof material and is a multi-layer building structure which comprises an interval tunnel, a platform, a station hall, an equipment room and the like. The whole entity model can be dismounted and combined. The fire source system can simulate different fire hazard scenes and generate approximately real hot smoke of the fire hazard. A problem of being difficult to develop a field experiment research on the urban mass transit subway fire hazard accident can be solved by the experiment system platform. Three-dimensional experiment simulation of subway fire hazard accident of different station structures, such as underground, deeply burying, an elevated type, an island style, a side type, a central nave and the like.
Owner:上海日浦信息技术有限公司

Fire simulation experiment equipment for caverns in hydraulic and hydro-power engineering and simulation experiment method

The invention relates to fire simulation experiment equipment for caverns in hydraulic and hydro-power engineering. The equipment comprises a cavern simulation system, a fire source system, a ventilation and smoke discharge system, a detecting and warning system and a measurement, collection and data analysis system, wherein the cavern simulation system is used for simulating a three-dimensional restricted space of fire generation; the fire source system is used for simulating different fire scenes and can be arranged at any position in the constituent parts of the cavern simulation system; the ventilation and smoke discharge system is used for simulating ventilation and smoke discharge in the cavern; and the detecting and warning system is used for detecting, identifying and warning on the fire inside the cavern simulation system; and the measurement, collection and data analysis system is used for measuring, collecting and processing data, comparing and analyzing experimental data and forecasting and estimating an accident. The equipment and the method of the invention can be used for carrying out experimental study on generation and development mechanism, ventilation, smoke discharge, control and prevention of the cavern fire in the hydraulic and hydro-power engineering, and providing reasonable and correct scientific proofs for engineering design and operation of underground caverns construction and fire safety of construction.
Owner:CHINA ACAD OF SAFETY SCI & TECH

Classified display and quantitative detection method for martensite and residual austenite in M-A island

ActiveCN104111230AEffective separate quantitative analysis of contentEfficient separate quantification of distributionsPreparing sample for investigationColor/spectral properties measurementsAlcoholRoom temperature
The invention relates to microstructure classified display and quantitative detection technology in iron and steel material, belongs to the field of iron and steel material, and particularly relates to a classified display and quantitative detection method for martensite and residual austenite in low-alloy granular bainite steel martensite / austenite island (M-A island). The method comprises steps: (1) a grinding and mechanical polishing method is used for preparing a low-alloy granular bainite steel metallographic sample; (2) an electrolytic polishing method is used for removing the stress layer on the surface of the metallographic sample, a nitric acid alcohol solution of 2wt% to 6wt% is then used for carrying out pre-corrosion for 5 to 15s, and absolute alcohol is finally used for ultrasonic cleaning for 10 to 20m; (3) the metallographic sample after ultrasonic cleaning is placed in a furnace free of atmosphere protection at the temperature of 150 to 300 DEG C for heat preservation for 2 to 6 hours, and when getting out of the furnace, the metallographic sample is placed in a dryer for air cooling till the room temperature; (4) the microscopic structure is observed in a metallographic microscope, wherein polygonal ferrite and bainitic ferrite are bluish violet, the martensite is brown and the residual austenite is off-white; and (5) distribution of each phase of the structure and quantitative analysis are carried out.
Owner:SHANGHAI SHENJIANG FORGING

Preparing water soluble chitosan or in small molecular weight through radiation method

The invention belongs to a method for preparing small molecular weight or water-solubility chitosan by using radiation process. It is characterized by that a refined high molecular weight chitosan solid or solution can be irradiated by using 60 Co gamma-rays and degraded, and the degradation product is undergone the after-treatment steps of dissolution and decolouration, etc. so as to obtain the invented small molecular weight or water-solubility chitosan. Said chitosan has several purposes, can be used as agricultural production-increasing agent, food drying agent, natural anti-bacterial material and bio-medicine material, etc.
Owner:CHANGCHUN INST OF APPLIED CHEMISTRY - CHINESE ACAD OF SCI

Preparation method of transition metal sulfide catalytic material and catalytic application thereof

The invention belongs to the technical fields of industrial catalysis and fossil energy conversion, and discloses a preparation method of a transition metal sulfide catalytic material and catalytic application thereof. The method comprises the following steps: using soluble thio transition metal salt as a metal source, obtaining an organic precursor containing thio metal salt by reacting with an alkyl surfactant or a template agent, carrying out in situ or ex situ temperature-programmed pyrolysis on the precursor, and obtaining an unsupported transition metal sulfide catalyst with high hydrogenation activity and high specific surface area; loading the organic precursor of the thio metal salts to a carrier by an impregnation method, and preparing a supported transition metal sulfide catalyst with high activity by thermal decomposition. The preparation method used has advantage of unnecessary sulfurizing pretreatment, simple process, energy saving and environmental protection. The unsupported catalyst and the supported catalyst are prepared by hydrogenation, deep processing of shale oil, selective hydrocracking of C9 hydrogen by quinoline and the like, and show excellent catalytic properties.
Owner:DALIAN UNIV OF TECH

Perovskite thin film as well as preparation method and application thereof

The present invention discloses a perovskite thin film as well as a preparation method and application thereof. The method comprises: taking lead acetate as a lead source and processing by a one-step solution method; and taking a mixed solution of the lead acetate and CH3NH3I as a precursor solution and coating the solution on a hole transporting layer to obtain the perovskite thin film. The obtained thin film can be used as the perovskite thin film which can be used in a perovskite solar battery. The lead acetate is used as a precursor of perovskite so that the flatness of a film surface is effectively improved and the compounding of carriers on an active layer interface is greatly reduced; and a solvent-resisting performance of materials is improved and the performance of the device is remarkably improved. The method also has the advantages of simple preparation process, low cost and good experiment repeatability and the like, and is suitable for large-scale industrial production.
Owner:NORTH CHINA ELECTRIC POWER UNIV (BAODING)

Electrochemical metallographic etching method universal for nickel-based alloys

The invention discloses an electrochemical metallographic etching method universal for nickel-based alloys and relates to the electrochemical etching of the metallographic structure of a metal material. The method adopts the electrochemical metallographic etching method and takes an etching solution as a conducting medium, a metallographic specimen to be observed as an anode and a platinum electrode as cathode; the etching-control conditions comprise: the constant etching voltage: 2V / cm<2>-8Vcm<2>, the etching time: 1min-5min, the etching solution thereof contains in percentage by weight, 65%-85% of phosphoric acid, 5%-15% of sulfuric acid, 8%-15% of chromic acid and 3%-8% of glycerol, the prepared high-temperature corrosion-proof nickel-based alloys such as G-3, 825, X750 and the like have flat surface of metallograph, clear crystal boundary and clear crystal grain. Compared with chemical etching method, the electrochemical metallographic etching method has easily-controlled experimental conditions, good experimental repeatability and high experimental efficiency and is suitable for Ni-Fe-Cr alloys.
Owner:UNIV OF SCI & TECH BEIJING

Plane heterojunction perovskite solar cell capable of being processed through solutions and manufacturing method thereof

The invention belongs to the technical field of perovskite solar cells, and particularly relates to a plane heterojunction perovskite solar cell capable of being processed through solutions and a manufacturing method of the solar cell. A cathode decoration layer in the plane heterojunction perovskite solar cell is made of metal acetylacetone chelate membrane materials. The metal acetylacetone chelate is introduced into the solar cell to selectively collect electrons so as to prevent a cavity, the metal acetylacetone chelate is in ohmic contact with an active layer, the open-circuit voltage of the cell reaches the optimal value, the current and fill factors are correspondingly improved, the optical separation effect is achieved, the internal photoelectric field is redistributed, and therefore light absorption is enhanced, and the excellent performance is achieved in polymer solar cells. The manufacturing method of the perovskite solar cell has the advantages of being simple in process, low in cost, good in experimental repeatability, suitable for large-scale industrial production and the like.
Owner:NORTH CHINA ELECTRIC POWER UNIV (BAODING)

Culture method for inducing adipose tissue-derived stromal cells to differentiate to chondrocyte

The invention relates to a culture method for inducing adipose tissue-derived stromal cells to differentiate to chondrocyte, and aims to solve the problem that the prior art is low in differentiation rate. The culture method comprises the following steps: 1) performing separation of primary cells of adipose tissue-derived stromal cells; 2) performing amplification and passage of the adipose tissue-derived stromal cells; and 3) performing differentiation culture on P5-generation adipose-derived stem cells to chondrocyte, namely, adding the adipose tissue-derived stromal cells into a condition culture medium, namely, an adipose tissue-derived stromal cell chondrocyte differentiation culture medium, after P5 generation of passage, performing chondrocyte differentiation culture, replacing the medium of the cells every 3 days, observing the morphological change of the cells, and after 16 days of induction, performing Alcian blue dyeing, and identifying the chondrocyte differentiation situation of the adipose tissue-derived stromal cells. The result of Alcian blue dyeing identification shows that the chondrocyte can be formed, and the Alcian blue dyeing is positive. The culture method has the characteristics of being simple and feasible, short in induction time as the induction culture medium is a serum-free culture system, good in test repeatability and high in osteoblast differentiation rate.
Owner:中卫华医(北京)生物科技有限公司 +1

Shale crushing experimental device capable of considering drill string dynamic vibration and experimental method

The invention provides a shale crushing experimental device capable of considering drill string dynamic vibration and an experimental method. The device comprises a one-layer plate, a drilling pressure detection device, a two-layer plate, a plane thrust ball bearing, a three-layer plate, a clamping device, a torque detection device, a displacement detection device, a data acquisition system, a drill string and a drill bit. The shale crushing experimental device is characterized in that a cantilever beam pressure sensor is mounted in a center position between the one-layer plate and the two-layer plate, the three-layer plate can freely rotate through the plane thrust ball bearing between the two-layer plate and the three-layer plate, and the torque of the drill string acts on the cantilever beam pressure sensor fixed on the one-layer plate through the rotation of the three-layer plate; a displacement sensor pull rod is connected with a plastic circular ring, a rolling bearing is stuck into the plastic circular ring, and a T-shaped steel tube stuck into the rolling bearing is connected with the drill string to measure the displacement of the drill string. With the adoption of the device and the method, the influence of dynamic vibration, drilling pressure, drilling footage and the torque of the drill string on shale crushing can be determined; an experimental basis is provided for anisotropic shale optimization drilling.
Owner:SOUTHWEST PETROLEUM UNIV

Acid rock reaction single-rock-plate crack simulation device and working method thereof

ActiveCN106290784ASmall scaleEasy to disassemble and repeat experimentsEarth material testingChemistryMicroscope
The invention relates to an acid rock reaction single-rock-plate crack simulation device and a working method thereof. The core portion of the acid rock reaction single-rock-plate crack simulation device is a visual slab model, the visual slab model comprises a joint plate corrosion clamp holder, a support, a microscope, a rotating device and the like. The invention further provides the working method of the acid rock reaction single-rock-plate crack simulation device. The acid rock reaction single-rock-plate crack simulation device is compact in whole structure, has strong pressure bearing capability, can achieve simulation of the crack acidification situations of different stratigraphic dips (0-90 degrees) through the rotating device and can achieve dynamic observation of earthworm hole growth and extension situations and earthworm hole competition situations.
Owner:CHINA UNIV OF PETROLEUM (EAST CHINA)

Rhotanium nano rod with good near-infrared light absorption performance and photoelectrocatalysis performance and preparing method of rhotanium nano rod

The invention relates to a rhotanium nano rod and a preparing method of the rhotanium nano rod. The rhotanium nano rod and the preparing method of the rhotanium nano rod are characterized in that the obtained rhotanium nano rod has good near-infrared light absorption performance and photoelectrocatalysis performance. The method includes the steps that firstly, a sodium borohydride reduction method is used for preparing gold nanoparticle seeds in a cetyl trimethyl ammonium bromide water solution; secondly, chloroauric acid, disodium tetrachloropalladate, silver nitrate and a hydroquinone water solution are sequentially added into the cetyl trimethyl ammonium bromide water solution under the stirring condition, and a growth solution for preparing the rhotanium nano rod is obtained; and thirdly, a certain amount of a gold nanoparticle seed colloidal solution is added into the growth solution prepared in the second step, a reaction is carried out for 0.5 h to 3 h at the temperature ranging from 40 DEG C to 70 DEG C, and a green rhotanium nano rod colloid solution is obtained. The obtained rhotanium nano rod with the good near-infrared light absorption performance and photoelectrocatalysis performance has important application value in the aspects of photocatalysis, electrocatalysis, photoelectronic devices, information storage, near-infrared photothermal treatment and the like.
Owner:UNIV OF JINAN

Method for preparing multi-metal nanoparticles by one-step coreduction

The invention belongs to the technical field of preparation of metal nanoparticles, and relates to a method for preparing multi-metal nanoparticles by one-step coreduction through citrate, particularly to the method for preparing the multi-metal nanoparticles with different sizes and morphologies by heating and boiling a mixed solution of a variety of metal ions and adding a citrate solution into the mixed solution rapidly, or heating and boiling the citrate solution and adding the mixed solution of a variety of metal ions into the citrate solution rapidly. The method can be used for preparing the multi-metal nanoparticles with high-efficiency catalytic activity easily and rapidly on a large scale. The gold source is HAuCl4.4H2O or HAuBr4.H2O, the palladium source is K2PdCl6 or K2PdCl4, the silver source is AgNO3 or AgF, the platinum source is K2PtCl6 or H2PtCl6.6H2O, and the citrate is sodium citrate, potassium citrate or ammonium citrate.
Owner:JILIN UNIV

Method for preparing oil soluble semiconductor nanocrystalline without phosphine

The invention belongs to the technical field of semiconductor nanocrystallines and relates to a method for preparing an oil soluble semiconductor nanocrystalline with high quality. The method comprises the following steps of: preparing a selenium precursor by reducing and dissolving selenium powder in aliphatic amine by using alkyl sulfhydryl; and preparing the oil soluble semiconductor nanocrystalline with high quality by using the selenium precursor. During the preparation process, used raw materials comprise a metal source (a cadmium source, a copper source, a zinc source, a tin source, an indium source and a gallium source), the selenium powder, the aliphatic amine, the alkyl sulfhydryl and octadecene. The selenium precursor is prepared by reducing the selenium powder with the alkyl sulfhydryl, the alkyl sulfhydryl is low in price, and harmless and environment-friendly, and can stably exist in air, and the reaction of reducing the selenium powder with the alkyl sulfhydryl can be finished in the air, so the method reduces the cost for preparing the nanocrystalline effectively, is environment-friendly and is very suitable for industrial production.
Owner:JILIN UNIV

Preparation method of hybrid high performance reverse osmosis membrane based on dopamine modified nanoparticles

The invention aims to provide a preparation method of a hybrid high performance reverse osmosis membrane based on dopamine modified nanoparticles. The method includes: firstly modifying inorganic nanoparticles with dopamine in an alkaline solution, then dispersing the modified nanoparticles evenly in an aqueous phase solution, then preparing a multi-component acyl chloride oil phase solution, andconducting interfacial polymerization to prepare the reverse osmosis membrane. Because of autopolymerization of a dopamine aqueous solution on a solid surface, dopamine can form a polydopamine layer strongly attached to a base membrane. As polydopamine is too dense, dopamine monomers in the aqueous phase can hardly be adsorbed to nanoparticles encapsulated by polydopamine, therefore, in the process of interfacial polymerization, due to the deletion of polyamine monomers, a cavity is formed between the nanoparticles and a matrix, and is just conducive to the passage of water molecules. By optimized selection of the modified nanoparticle components and various membrane preparation conditions and regulation of the post-treatment temperature, the high performance reverse osmosis membrane is prepared.
Owner:浙江海纳环保科技有限公司

Gene marker of major gene Bph14 for resisting brown planthopper in rice and application thereof

The invention relates to a gene marker of a major gene Bph14 for resisting brown planthopper in rice and application thereof. The gene marker Bph14-M1 of Bph14 has the following sequences of forward and reverse primers: a forward primer of (5'-3') AGCCACTTGGTGAACTTATT, and a reverse primer of (5'-3') GATTGACGATGAGGAGACTT. The application method includes 1) extracting rice genomic DNA; carrying out PCR amplification on the rice genomic DNA by using the forward and reverse primers; and carrying out electrophoresis detection on amplification products. The invention employs the marker to assist selection and can accurately transform the brown planthopper resistant gene Bph14 in B5 to a brown planthopper susceptible cultivar and greatly improve the breeding efficiency of brown planthopper resistant varieties.
Owner:江西省农业科学院水稻研究所

Material dynamic mechanical parameter acquisition device and method

InactiveCN108519283AAvoid conditions where stress waves are difficult to precisely controlAvoid conditions that are difficult to precisely controlMaterial strength using tensile/compressive forcesMaterial strength using steady torsional forcesEngineeringGeneration time
The embodiment of the invention provides a material dynamic mechanical parameter acquisition device and method, and aims to solve the problem of low stress wave control accuracy in the prior art. Thedevice comprises an electromagnetic type Hopkinson pull rod loading unit, an electromagnetic type Hopkinson torsion rod loading unit, a stress wave synchronization unit and an acquisition unit. The method comprises the steps of loading a pulling stress wave; loading a torsion stress wave; acquiring a pulling stress parameter of a sample; and acquiring a torsion stress parameter of the sample, wherein the pulling stress parameter of the sample and the torsion stress parameter of the sample are adopted as material dynamic mechanical parameters. According to the material dynamic mechanical parameter acquisition device and method provided by the embodiment of the invention, a torsion stress wave generating device and a pulling stress wave generating device driven by electromagnetism are applied to a Hopkinson pulling-torsion coupling experiment, so that the generation time, the pulse width and the amplitude of a torsion stress wave and a pulling stress wave produced by the experiment device can be accurately controlled.
Owner:NORTHWESTERN POLYTECHNICAL UNIV

Soliton optical frequency comb generation device and operation method thereof

ActiveCN109494559AReduce complexityFrequency tuning speed effectLaser detailsFrequency combRepeatability
The present invention provides a soliton optical frequency comb generation device and an operation method thereof. The device comprises an adjustable pulse laser, a first connection optical fiber, anoptical amplifier, a second connection optical fiber, a polarization controller, a third connection optical fiber, a first circulator, an assistant test output optical fiber, a fourth connection optical fiber, a ceramic ferrule microcavity, single-layer grapheme, an output optical fiber, a first C-type ceramic tube and a second C-type ceramic tube. The device employs the single-layer grapheme andthe FP microcavity structure to generate a soliton optical frequency comb with 10GHz frequency comb intervals in a condition without tuning of the pump laser frequency, and therefore, the soliton optical frequency comb generation device and the operation method thereof are high in integration level, low in power consumption, simple and convenient to operate and good in output result repeatability.
Owner:SHANGHAI JIAO TONG UNIV

Boron-nitrogen co-doped carbon quantum dot as well as preparation and application thereof

ActiveCN110982520ANo obvious morphological damageObvious morphological damageMaterial nanotechnologyNanoopticsFluoProbesQuantum yield
The invention relates to a boron-nitrogen co-doped carbon quantum dot which is prepared by taking o-phenylenediamine as a carbon source and a nitrogen source, boric acid as a boron source doping agent, through microwave-assisted hydrothermal reaction in water and reaction product purification. The boron-nitrogen co-doped carbon quantum dot prepared by the invention has a particle size of less than10nm, can emit yellow fluorescence with a long wavelength of 560nm under excitation, has high fluorescence quantum yield, has excitation independence, low toxicity and good biocompatibility, and canbe used as a fluorescent probe in cell imaging.
Owner:TAIYUAN UNIV OF TECH

Preparation method Fe/ZSM-5 catalyst for directly decomposing N2O

The invention relates to a method for preparing an Fe / ZSM-5 catalyst for directly decomposing N2O, which comprises the following steps: (a), roasting NH4-ZSM-5 zeolite molecular sieves at a temperature of between 500 and 600 DEG C for 2 to 6 hours, cooling and sealing the NH4-ZSM-5 zeolite molecular sieves, and moving the NH4-ZSM-5 zeolite molecular sieves into a drying cabinet; (b), mixing and grinding the zeolite molecular sieves treated in the step a and an iron salt precursor, raising the temperature to be between 300 and 400 DEG C in inert atmosphere, and maintaining the mixture for 1 to 2 hours, wherein the content of iron is 0.01 to 10 weight percent of the total weight of the zeolite molecular sieves and the iron salt precursor; (c), cooling the product in the step b, and hydrolyzing the product in vapor-containing inert atmosphere for 1 to 2 hours at a temperature of between 150 and 200 DEG C; and (d), roasting the product in the step c in oxygen atmosphere for 1 to 2 hours at a temperature of between 500 and 600 DEG C and at a temperature rise speed of between 1 and 8 DEG C per minute.
Owner:KAILING CHEM ZHANGJIAGANG CO LTD

Preparation method for nickel phosphide with hollow core-shell structure

The invention relates to a preparation method for nickel phosphide with a hollow core-shell structure. The preparation method comprises the following steps: firstly, adding deionized water in the polytetrafluoroethylene liner of a reaction kettle, weighing soluble nickel salt, adding the soluble nickel salt into the deionized water and stirring by a magnetic stirrer until the soluble nickel salt is dissolved; then adding an anionic surfactant and a cationic surfactant and stirring until the anionic surfactant and the cationic surfactant are completely dissolved; adding elementary substance phosphorus into the solution, then sealing the polytetrafluoroethylene liner into a stainless steel die, heating from the room temperature under the closed condition, moving obtained black precipitates to a centrifuge tube after the reaction is completed, sequentially and repeatedly washing by benzene, water and absolute ethyl alcohol and centrifuging; finally, placing the washed product into a vacuum drying box to obtain the nickel phosphide with the hollow core-shell structure. The prepared nickel phosphide catalyst with the hollow core-shell structure has excellent photocatalytic performance on organic dye, the preparation method is simple to operate, the reaction is easy to control, good repeatability is achieved and heat treatment at the later period is not required.
Owner:SHAANXI UNIV OF SCI & TECH

Arabidopsis hydroponic method capable of effectively preventing generation of green algae

The invention provides an arabidopsis hydroponic method capable of effectively preventing generation of green algae. The method comprises the following steps: 1, raising a seedling, wherein sterilized and vernalized seeds are sowed in 1 / 2 MS solid medium in a cultivation bottle and cultivated for 12-18 days to obtain a seedling; 2, transferring the seedling, wherein the seedling obtained from the step 1 is transferred to a small KT plate which has an area of 3-5 square centimeters and is provide with a hole, the roots penetrate into a nutrient solution through the hole and are acclimated and cultivated for 5-7 days; 3, self-making and disinfecting a cultivation device, and sealing the cultivation device by a piece of tin foil paper; and 4, cultivating the seedling, wherein the seedling on the small KT plate is transferred to the self-made cultivation device, the roots of the arabidopsis are immersed into the cultivation solution through the piece of tin foil paper and the cultivation device, and the cultivation solution is changed once every 6-9 days and is ventilated once every 2-3 days so as to ensure enough oxygen at the root area. The cultivation area provided by the invention is simple and easy to implement. Moreover, the arabidopsis grows well and the green algae can not be generated.
Owner:SHANDONG UNIV OF TECH

Micro double-bed solid fuel decoupling combustion reaction dynamic analyzer

ActiveCN103543237AAchieve pyrolysisRealize the coke combustion processChemical analysis using combustionAir atmosphereGas detector
The invention provides a micro double-bed solid fuel decoupling combustion reaction dynamic analyzer which comprises a fuel pyrolytic reaction generation device, a residual coke combustion reaction generation device, a double-bed high-temperature coupling device, a gas path device and an analysis test device, wherein solid fuel is firstly pyrolyzed under an inert atmosphere in a micro gas flow bed; then residual cokes enter the micro gas flow bed for combustion test under an air atmosphere; a quick gas detector is used for judging a reaction mechanism by measuring a generation sequence and a generation quantity characteristic of gas components in a fuel pyrolysis process and a coke combustion process, so that reaction dynamic parameters can be calculated. According to the micro double-bed solid fuel decoupling combustion reaction dynamic analyzer, the combustion dynamic parameters of the solid fuel can be tested through direct decoupling combustion through independent and quick switching of the atmospheres and the temperature; the pyrolyzed residual cokes are directly subjected to the combustion test without a cooling process; the temperature rising rates of the gas flow bed and a fluidized bed are high, so that a combustion condition in an actual boiler can be well simulated; the measured reaction dynamic parameters are close to intrinsic reaction dynamic parameters.
Owner:HUAZHONG UNIV OF SCI & TECH

Polymer solar battery with inverted structure and fabrication method thereof

The invention discloses a polymer solar battery with an inverted structure and a fabrication method thereof, belonging to the technical field of polymer solar battery. The polymer solar battery with an inverted structure comprises a substrate, a transparent conductive metal oxide electrode layer, an electron collection layer, a photovoltaic active layer, a hole collection layer and a high work function anode layer, which are sequentially stacked, wherein the electron collection layer is a titanium acetylacetonate membrane. The electron collection layer can be prepared by a spin coating method and can be introduced into the polymer solar battery with the inverted structure to achieve high-efficiency electron collection. Compared with TiO2 prepared by the traditional sol-gel method, the polymer solar battery with an inverted structure has the advantages of high photoelectric conversion efficiency, low cost, good experimental repeatability and the like, can be prepared by simple process and is suitable for large-scale industrial production.
Owner:NORTH CHINA ELECTRIC POWER UNIV (BAODING)

Extraction method for mangrove plant kandelia candel leaf total protein suitable for two-dimensional electrophoresis

The invention discloses an extraction method for mangrove plant kandelia candel leaf total protein suitable for two-dimensional electrophoresis. A traditional trichloroacetic acid / acetone precipitation method for protein extraction and a traditional phenol extraction method for protein extraction are combined, a cosolvent SDS solution is introduced, the extraction process is optimized, and the Phe-B method suitable for extraction of the mangrove plant kandelia candel leaf total protein is established. The extraction efficiency and quality of the protein are effectively improved, and the technical scheme can be specifically suitable for extraction of the kandelia candel leaf protein in two-dimensional electrophoresis. The method has the advantages of being easy to operate, high in protein extraction efficiency and fewer in interfering substance, and is suitable for materials with difficult protein extraction, low protein extraction efficiency and more interfering substances. The extracted kandelia candel leaf protein completely meets the requirements of the first direction and the second direction of two-dimensional electrophoresis, a high-quality two-dimensional electrophoresis gel map with high resolution, more clear protein points, uniform distribution and the clear background can be obtained, and experiment repeatability and stability are good.
Owner:SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI

Preparation method of Curdlan oligomers

The invention discloses a preparation method of Curdlan oligomers. The method comprises the following steps of: fully dissolving Curdlan polysaccharide into a solvent to obtain a homogeneous solution; adding acid at a temperature in a range of 80-140 DEG C, wherein a final concentration of the acid in the solution is 0.1-10 M; reacting for 30-500 min; adding organic solvent sediments which are 3-5 times as much as the volume of reaction liquid and meanwhile, stirring and filtering to obtain a milky solid; washing the solid by the organic solvent 1-4 times to obtain the Curdlan oligomers with an average molecular weight of 340-4000 Da, which is measured by an efficient liquid phase detection after drying. The degradation efficiency of the preparation method reaches more than 85%. The Curdlan oligomers are oligomers formed by connecting glucose molecules through beta-(1->3) glucosidic bonds; the degree of polymerization (Degree of Polymerization, DP) of the Curdlan oligomers is 2-24; a molecular formula of the Curdlan oligomers is (C6H12O6)n, wherein n is equal to 2-24. The average molecular weight of the Curdlan oligomers is 340-4000 Da. The preparation method provided by the invention has a simple and controllable preparation process, short reaction time and good degradation efficiency, and is environmentally friendly and suitable for industrial production.
Owner:DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI

MoS2/In2S3 composite catalyst serving as photoelectrocatalytic dehydrogenation material and preparation method of MoS2/In2S3 composite catalyst

The invention relates to a MoS2 / In2S3 composite catalyst serving as a photoelectrocatalytic dehydrogenation material and a preparation method of MoS2 / In2S3 composite catalyst. The preparation method includes: configuring a mo source, an indium source and a sulfur source into a solution which is mixed and stirred; subjecting the solution to uniform ultrasonic dispersion, and preparing the MoS2 / In2S3 composite catalyst on an ITO glass substrate by the aid of a one-step hydrothermal method. The MoS2 / In2S3 composite catalyst not added with any surfactants is environment friendly, the preparation method is easy to operate, and the MoS2 / In2S3 composite catalyst is the excellent photoelectrocatalytic dehydrogenation material.
Owner:BEIJING UNIV OF CHEM TECH

Installation method of fluorescent visual high-transfer human liver cancer nude mouse model

The invention belongs to the field of microorganism animal cell system, and relates to an establishment method of a fluorescence visualization human hepatoma nude mice model which can self emit high strength red or green fluorescences and has the metastatic ability. After obtaining a human high-metastatic fluorescence hepatoma cell line HCCLM3-R, HCCLM3-G, HCCLM6-R and HCCLM6-G of fluorescence genes with high chromosome conformable degree, high fluorescence intensity and stable expression by using the method of pseudotype slow virus infection, hepatoma cells expressed by the fluorescences is placed beneath nude mice skin to establish a fluorescence visualization high-metastatic human hepatoma nude mice subcutaneous tumor model or subcutaneous fluorescence expression tumor tissues is placed in nude mice hepar to establish a fluorescence visualization high-metastatic human hepatoma nude mice hepar primary tumor model. The got model can be used as a tracer of animal in vivo hepatoma cells, and can be used for molecular mechanism study of hepatoma recurrence and metastatic and prophase therapeutic effect discrimination for new anti-hepatoma therapy and new anti-hepatoma drugs, etc.
Owner:ZHONGSHAN HOSPITAL FUDAN UNIV

Supported silver nanonet, and preparation method and application thereof

The invention discloses a supported silver nanonet, and a preparation method and application thereof. The preparation method comprises the following steps: by using a copper sulfate-n-propanol mixed solution as an electrolyte, Ag / AgCl as a reference electrode, a platinum sheet as a counter electrode and ITO (indium tin oxide) as a work electrode, preparing cuprous oxide nano cubes supported on an ITO substrate by a constant voltage process, cleaning the surface, drying in a vacuum drying oven, adding silver nitrate to sufficiently react by using the cuprous oxide nano cubes supported on the ITO substrate as a template and reducer, taking out, cleaning with deionized water, and carrying out vacuum drying to obtain the ITO-supported net silver nano structure which is the supported silver nanonet. The material can be used for electrochemical reduction of carbon dioxide. The net silver nano structure electrode material has application potential in electrochemical catalytic reduction of carbon dioxide. The preparation method is simple to operate and easy to control, and does not generate any toxic substance.
Owner:WUHAN UNIV