Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of outer membrane protein Omp22 as acinetobacter baumannii vaccine target

A technology of Acinetobacter baumannii and outer membrane protein, which is applied in the fields of molecular biology and immunology, and can solve problems such as difficulty in improving yield, complex mechanism of Baumann's drug resistance, and severe drug resistance

Active Publication Date: 2016-04-20
INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The main reasons why Acinetobacter baumannii can cause serious clinical harm are: (1) Baumannii is widely distributed in the hospital environment and can survive for a long time. It mainly exists in human skin, respiratory tract, digestive tract and genitourinary tract. Ultraviolet rays and chemical disinfectants have strong resistance, and conventional disinfectants can only inhibit its growth but not kill it
(2) Most importantly, Bowman's drug resistance mechanism is complex and drug resistance is serious
[0006] It is worth noting that Acinetobacter baumannii OMPs or OMVs are composed of many proteins, and the separation and purification of these proteins is a complicated process, and the yield is difficult to improve, and the active ingredients are mixed with a large number of irrelevant proteins and impurities
Although immunization with OMPs or OMVs is safer than whole-bacteria immunization, it contains many outer membrane and cell wall components of the bacteria, including LPS, which still produces significant toxic and side effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of outer membrane protein Omp22 as acinetobacter baumannii vaccine target
  • Application of outer membrane protein Omp22 as acinetobacter baumannii vaccine target
  • Application of outer membrane protein Omp22 as acinetobacter baumannii vaccine target

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Example 1: Construction of a prokaryotic expression plasmid for the outer membrane protein Omp22 of Acinetobacter baumannii

[0033] The Acinetobacter baumannii strain ATCC17978 was cultured overnight in LB medium until the bacteria grew to the logarithmic phase (OD 600=0.4-0.6), the bacterial liquid was taken for PCR amplification, and the PCR amplification primers were Omp22-F (5'GGATCCATGCGTGCATTAGTTATTT3'); Omp22-R (5'GAATTCTTATTGTTTAGCATAAATG3'); the specific PCR system was: bacterial liquid: 2 μL; Omp22 -F: 2 μL; Omp22-R: 2 μL; dNTP: 2 μL; Taq enzyme: 0.25 μL; 10×Taq enzyme buffer: 2.5 μL; water: 14.25 μL. The PCR program was: ①pre-denaturation at 94°C for 5 minutes; ②denaturation at 94°C for 30 seconds; annealing at 56°C for 30 seconds; extension at 72°C for 1 minute, 35 cycles; ③final extension at 72°C for 10 minutes. The PCR product was gel-recovered (Beijing Tiangen Biology), and the recovered product was connected to the pMD19T-simple vector (Takara Company)...

Embodiment 2

[0034] Example 2: Induced Expression of Acinetobacter baumannii Omp22 Recombinant Protein

[0035] Transform the recombinant plasmid into BL21(DE3) competent cells, and pick a single clone to induce expression. The specific method is to inoculate the positive clone into LB medium that has been added with ampicillin (100 mg / mL), and culture it for 16 hours. Transfer the bacteria liquid into the new LB medium with ampicillin at a ratio of 1:5. When the strain grows to the logarithmic phase, add IPTG (1mmol / L) to induce expression, control the induction expression temperature at 37°C, and induce Express 6 hours ( figure 2 ).

Embodiment 3

[0036] Example 3: Preparation and purification of Omp22 subunit vaccine antigen

[0037] Centrifuge the sample after overnight induction at 12,000 g at room temperature for 10 minutes to collect the bacteria, wash the bacteria twice with PBS, and then ultrasonically disrupt the cells at 10% maximum power, work for 5 seconds, stop for 5 seconds, and last for 10 minutes. The crushed sample was centrifuged at 12000g for 10 minutes, and the inclusion body precipitate was collected. The inclusion body was washed 3 times with Washbuffer (20mMtris-Hcl, pH8.8, 1M urea) and then added to Solutionbuffer (20mMtris-Hcl, pH8.8, 8M urea). Dissolved, the dissolved inclusion bodies were dialyzed with Bindingbuffer (20mMtris-Hcl, pH8.8) at 4°C overnight for refolding, the dialysate was purified with HisTrapFF (GEHealthcare), and filtered through Elutionbuffer (20mMtris-Hcl, pH8.8, 1M imidazole ) after gradient elution, the purified products of different components were collected and detected b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of molecular biology and immunology, and particularly provides subunit vaccine antigen protein of acinetobacter baumannii and an application method of the subunit vaccine antigen protein. A gene nucleotide sequence of outer membrane protein Omp22 of the acinetobacter baumannii is represented as SEQ ID NO:1, encoded protein is the subunit vaccine antigen protein of the acinetobacter baumannii, and an amino acid sequence is represented as SEQ ID NO:2. The preparation method of the subunit vaccine antigen protein comprises steps as follows: a prokaryotic expression plasmid Omp22-pThioHisA of an Omp22 vaccine antigen is constructed, is converted to enter BL21 (DE3), and is recycled after induced expression, Omp22 recombinant protein is purified and is mixed with an aluminum hydroxide adjuvant, a mixed liquid can stimulate an organism to produce a specific antibody, and the specific antibody has an efficient immune protection function on acinetobacter baumannii infection and can be used for preventing the acinetobacter baumannii infection.

Description

technical field [0001] The invention relates to the fields of molecular biology and immunology, in particular to an immunoprotective subunit vaccine and its application. Background technique [0002] With the rapid development of medical technology, especially the widespread use of antibiotics, the level of treatment of infectious diseases has been continuously improved, but the phenomenon of abuse of antibiotics has increased. Under the strong pressure of antibiotics, a large number of After repeated contact with drugs, the sensitivity of these drug-resistant bacteria to drugs decreases or even disappears, resulting in reduced or even ineffective efficacy of drugs against drug-resistant bacteria. Acinetobacter baumannii (Acinetobacter baumannii, Ab) has become the most common clinical nosocomial infection pathogen. [0003] Bowman's infection can cause sepsis, soft tissue or wound infection, catheter-related infection, urinary tract infection, bacteremia, secondary menin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K39/02A61P31/04C07K14/21C12N15/11
CPCA61K39/0208A61K2039/55505C07K14/212
Inventor 马雁冰黄惟巍姚宇峰杨旭孙文佳刘存宝白红妹
Owner INST OF MEDICAL BIOLOGY CHINESE ACAD OF MEDICAL SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com