The Lrr-RLK receptor kinase ATMDIS1 and its use in breaking reproductive isolation between species

A technology of reproductive isolation and species, applied in the biological field, can solve problems such as hybrid sterility, hinder gene exchange, and cannot use heterosis breeding to achieve the effect of improving efficiency and increasing fertilization efficiency

Active Publication Date: 2019-02-15
INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The essence of all kinds of reproductive isolation is to hinder the gene exchange between different species. This isolation phenomenon has caused difficulties in agricultural production, such as hybrid sterility during hybridization, making it impossible for people to use heterosis for breeding
This reproductive isolation has caused certain negative effects on agricultural production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • The Lrr-RLK receptor kinase ATMDIS1 and its use in breaking reproductive isolation between species
  • The Lrr-RLK receptor kinase ATMDIS1 and its use in breaking reproductive isolation between species
  • The Lrr-RLK receptor kinase ATMDIS1 and its use in breaking reproductive isolation between species

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1. AtMDIS1 Transformation of Capsella rubella Positive Plants Screening and Identification of Gene Expression.

[0035] 1. Preparation of AtMDIS1 gene expression vector pLAT52:AtMDIS1-NOST driven by LAT52 promoter based on pBI101.

[0036] First, use the Arabidopsis genomic DNA as a template to amplify the DNA fragment of the AtMDIS1 gene with the nucleotide sequence shown in SEQ ID No.: 1, and the amplification primer is MDIS1-F1: TCCC CCCGGG ATGGGTTGTCGATGGAATCCAATT (SEQ ID No.: 4); MDIS1-R1: TCCC CCCGGG TTATGTAGCTTCAGAGGATAAGATCT (SEQ ID No.: 5) (the Xma I restriction site is underlined, and the 5' end of the restriction site is a protective base). The AtMDIS1 fragment was amplified from pollen with TOYOBOKOD Plus enzyme, and the amplified product was digested with Xma I and recovered; the pBI101 vector (available to the public from the Institute of Genetics and Developmental Biology, Chinese Academy of Sciences) was digested with HindⅢ and dephosphorylate...

Embodiment 2

[0044] Embodiment 2, test optimal Capsella rubella pollen germination medium Carry out Capsella rubella pollen germination test

[0045] Adjust the prepared pollen germination medium to pH 7.5, add Promega company's low-melting agarose (article number V2111) and cook in a water bath until the agarose is completely dissolved, and then place it in a small petri dish (3.2cm in diameter, Pour 1-2mL of culture medium into NEST company (Product No. GBD-35-15), and place it in a refrigerator at 4°C for 1-2 hours until it is completely solidified.

[0046] Spread wild-type Capsella rubella pollen evenly on the prepared medium under a dissecting microscope, put wet toilet paper under the small petri dish, and germinate in a constant temperature greenhouse for 8 hours and count the number of germinated pollen / total pollen ratio, to calculate the germination rate.

[0047] Table 1 explores the pollen germination efficiency statistics of the more optimized Capsella rubella pollen germina...

Embodiment 3

[0052] Example 3. Detection of the efficiency of pollen of AtMDIS1 transgenic plants entering mature unfertilized Arabidopsis ovules.

[0053] Arabidopsis thaliana and Capsella rubella were emasculated one day before flowering (use hybrid tweezers to peel off the petals of the unbloomed buds and remove all the anther filaments).

[0054] The pollen of Capsella rubella was pollinated to the unfertilized stigma. After 30 minutes, the stigma was cut off and placed flat on the pollen germination medium. After culturing for 8 hours, unfertilized ovules of Arabidopsis thaliana were placed near the pollen tube.

[0055] When cultured at 24°C for 12-14 hours, the efficiency of transgenic pollen tube orientation to ovules was observed under a Leica DM4000B LED fluorescent microscope.

[0056] Apply aniline blue staining solution (1% w / v aniline blue, SIGMA product number 415049), 100mM K 3 (PO 4 ) (Sinopharm Chemical Reagent Beijing Co., Ltd., pH 10.0), observed under ultraviolet lig...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses LRR-RLK receptor kinase AtMDIS1 having high expression in arabidopsis plant pollen and a method for breaking a close hybridization barrier through AtMDIS1. AtMDIS1 is expressed in species except arabidopsis through a transgenic means, gene exchange between different species can be promoted, and the hybrid sterility barrier in hybridization breeding is broken. Experiments prove that the method can successively improve arabidopsis ovule recognition efficiency of close species plant male gametophytes.

Description

technical field [0001] The application relates to but not limited to the field of biotechnology, in particular to the LRR-RLK (Leucine-richrepaeat-receptor like kinase) receptor kinase AtMDIS1 ( M ale dis cover 1 ) and its application; more specifically, it relates to a technique for breaking the reproductive isolation between species by transgenic means through transgenic means of the LAT52 promoter specifically expressed in pollen to drive the Arabidopsis receptor kinase encoding gene AtMDIS1. Background technique [0002] Due to various reasons, the isolation mechanism in which groups with close kinship do not mate under natural conditions, or even if they can mate, cannot produce offspring or produce fertile offspring, is called reproductive isolation. If reproductive isolation occurs before fertilization, it is called pre-fertilization reproductive isolation, including geographical isolation, ecological isolation, seasonal isolation, physiological isolation, morpholog...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/54C12N15/29C12N15/82A01H5/00A01H6/20
CPCC12N9/1205C12N15/8261C12Y207/01037
Inventor 杨维才李红菊王童陈伟
Owner INST OF GENETICS & DEVELOPMENTAL BIOLOGY CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap