Signal peptide and application thereof in recombinant bacteria for producing L-glutamic acid from konjaku flour

A technology of konjac flour and signal peptide, applied in the fields of genetic engineering, protein and enzyme engineering and metabolic engineering, can solve the problem that konjac flour cannot be directly used

Inactive Publication Date: 2016-04-20
JIANGNAN UNIV
View PDF8 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Brevibacterium tianjin SW07-1, a high-yield L-glutamic acid strain described and preserved in the patent (publication number: CN103243128A) authorized by our laboratory, can only use glucose as the main carbon source to ferment and produce L-glutamic acid. Konjac flour cannot be directly used as the main carbon source

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Signal peptide and application thereof in recombinant bacteria for producing L-glutamic acid from konjaku flour

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1: Primer Design of Signal Peptide Primer Tandem with β-Mannanase

[0018] According to the relevant gene sequence and β-mannanase gene sequence published on NCBI, the signal peptide and gene tandem large fragment primers were designed.

[0019] P1:pMSPmanHindIIIF

[0020] 5'-CCC AAGCTT ATGTTCAAAGAAGCACACCATCTCCCTGCTGATCATCTTCCTGCTGGCT

[0021] TCCGCTGTTCTGGCTAAGCCAATCGAGGCTCATACTGTGTCGCCTGTGAATC-3’

[0022] P2:pMSPmanBamHIR

[0023] 5'-CGC GGATCC TTACTCAACGATTGGCGTTA-3'

Embodiment 2

[0024] Example 2: β-mannanase gene signal peptide replacement and its cloning

[0025] [1] Chromosome was extracted from B. subtilis CCTCCM209200 as template DNA.

[0026] [2] Design signal peptide and gene tandem PCR primers according to the β-mannanase gene sequence published on the NCBI website. Using the genome of B. subtilisCCTCCM209200 as a template, a β-mannanase gene with a code-optimized nucleotide sequence such as Mannasesignalpeptide (MSP for short) signal peptide shown in SEQ ID NO: 1 was obtained by PCR with large fragment primers. PCR amplification system (50 μL): template 1 μL, upstream and downstream primers 0.5 μL, dNTPMix 4 μL, 10×ExTaqBuffer 5 μL, sterilized ddH2O 38.5 μL, ExTaq DNA polymerase 0.5 μL. PCR reaction conditions: 94°C pre-denaturation, 5min, one cycle; 94°C denaturation, 30s, 56°C annealing, 30s, 72°C extension, 1min30s, 30 cycles; 72°C, 10min, one cycle; 4°C, 10min, one cycle Cycling (in which annealing temperature and extension time are adju...

Embodiment 3

[0027] Embodiment 3: Construction of recombinant plasmid pXMJ19-MSPman

[0028] [1] Construct the recombinant plasmid pMD18-T-MSPman and introduce it into E.coliJM109. The product recovered by PCR in [2] was ligated with the cloning vector pMD18-T. The ligation system was 5 μL of solution I, 4.8 μL of the target gene, and 0.2 μL of the pMD18-T plasmid, and ligated overnight at 16°C. The ligation product was transformed into E.coilJM109, spread on an LB plate containing 100ug / mL ampicillin, cultured overnight at 37°C, picked a single colony into 10mL liquid LB medium containing 100ug / mL ampicillin, and shaken at 37°C After culturing overnight, the plasmid was extracted and named pMD18-T-MSPman. After PCR and restriction enzyme digestion verified that the connection was successful, the bacterial liquid was added to glycerol and stored in a -70°C refrigerator.

[0029] [2] The pMD18-T-MSPman plasmid extracted in [1] and the expression vector pXMJ19 were subjected to double diges...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a signal peptide and application thereof in recombinant bacteria for producing L-glutamic acid from konjaku flour, and belongs to the field of genetic engineering and enzyme engineering. The screened and codon-optimized signal peptide, namely SEQ ID No.1 is fused, by molecular cloning and genetic engineering techniques, with B. subtilis CCTCC M 209200-sourced beta-mannanase for construction of an expression vector for expressing in L-glutamic acid high-yield production bacterial stain. For the first time, the signal peptide is reported, wherein the signal peptide can be used for mediation of recombinant bacteria Brevibacterium tianjinese SW07-1 / pMSPman, which is capable of secreting the beta-mannanase, for producing the L-glutamic acid by fermentation of the chip konjaku flour, and the yield of a 5L fermentor is 65g / L under the condition of addition of an optimal carbon source.

Description

technical field [0001] A method for using a signal peptide to enable recombinant bacteria to efficiently secrete specific enzymes to metabolize cheap carbon sources for amino acid production and a method for efficiently producing certain proteins belong to the fields of genetic engineering, protein and enzyme engineering, and metabolic engineering. Background technique [0002] Konjac flour mainly contains konjac glucomannan, and its source is non-food crop konjac. According to relevant reports, konjac is suitable for planting in Yunnan, Guizhou, Sichuan, Hubei, western Hunan, and southern Shaanxi. At present, it has a certain scale, and the planting area of ​​konjac in Hubei alone reaches 410,000 mu. At present, konjac flour is mainly used in some foods, and its hydrolyzed oligosaccharides can be used as functional foods, but the application is not very extensive. Most microorganisms cannot be used directly. Therefore, it has a good application prospect to transform microo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/77C12N15/31C12N1/21C12N15/56C12P13/14C12R1/13
Inventor饶志明郑俊贤徐美娟杨套伟张显
OwnerJIANGNAN UNIV