Check patentability & draft patents in minutes with Patsnap Eureka AI!

A 5-plex rt-PCR detection kit for porcine viral diarrhea virus

A technique for RT-PCR and swine viral diarrhea, which is applied in the field of 5-fold RT-PCR detection kits for swine viral diarrhea virus, can solve the problems of difficult differential diagnosis, economic losses in the pig industry, and difficulty in diagnosing diarrhea.

Active Publication Date: 2018-10-30
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These viruses are the main pathogens that cause viral diarrhea in pig herds or pig farms, causing great harm and causing great economic losses to the pig industry every year
In addition, the clinical symptoms, pathological changes, and epidemic characteristics of viral diarrhea caused by the above-mentioned viruses are very similar, and it is difficult to make a differential diagnosis based on clinical diagnosis alone, which often leads to misdiagnosis. Diagnosis and differential diagnosis are particularly important
However, the complex etiology of diarrheal diseases and the limitations of existing diagnostic methods make it difficult for grassroots veterinarians and farms to diagnose diarrheal diseases, making the prevention and control of diarrheal diseases difficult to target and prescribe the right medicine
The most fundamental reason for this phenomenon is the lack of available fast, accurate and convenient commercial diagnostic kits
For a long time, the detection kits for porcine viral diarrhea are mainly based on the traditional serological detection methods of porcine transmissible gastroenteritis virus (TGEV), porcine epidemic diarrhea virus (PEDV) and porcine rotavirus (RV) However, two major changes have taken place in the epidemic of porcine viral diarrhea in recent years: first, it mainly causes disease and death in suckling piglets, and the immune system of suckling piglets has not yet fully developed and failed to effectively produce serum antibodies; second, in recent years, In the epidemic of porcine viral diarrhea in China, new viruses such as porcine Sapporo virus and crest virus exist from time to time, and there are no mature detection methods for these two viruses
It can be seen that the existing detection kits for detecting porcine viral diarrhea cannot meet the needs of current disease diagnosis, so there is an urgent need to develop a commercial detection kit that meets the current epidemic trend, and there is currently no one-time detection, diagnosis and PCR commercial kits for differential diagnosis of the above five pathogens

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A 5-plex rt-PCR detection kit for porcine viral diarrhea virus
  • A 5-plex rt-PCR detection kit for porcine viral diarrhea virus
  • A 5-plex rt-PCR detection kit for porcine viral diarrhea virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1. Design and synthesis of 5-fold RT-PCR primers for porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, porcine rotavirus, porcine Sapporo virus and porcine ridge virus

[0025] Using the sequence comparison of the known porcine epidemic diarrhea virus nucleoprotein, porcine transmissible gastroenteritis virus nucleoprotein, porcine rotavirus VP7 protein, porcine sapporo virus polyprotein and porcine ridge virus polyprotein gene sequence, find out its For the conserved region, 5-fold RT-PCR primers were designed using Oligo6 software, and the primer sequences were synthesized by Shenzhen Huada Gene Technology Co., Ltd. The sequences and lengths of the 5 pairs of primers are:

[0026]KF: ggcattgacatgaatcaggc (SEQ ID No. 1), KR: gcgatcgtaggtcttcgg (SEQ ID No. 1), 998bp;

[0027] TF: gggccaacgtaaagagcttcc (SEQ ID No. 3), TR: gctctgacctttctgcag (SEQ ID No. 4), 820bp;

[0028] PF: taggactcgtactgagggtgt (SEQ ID No. 5), PR: ctattttcgcccttgg...

Embodiment 2

[0031] Embodiment 2. Determination of reaction system and reaction conditions

[0032] First, a single primer is used to amplify the corresponding template at different concentrations such as figure 1 As shown, the optimal concentration of primers for screening 5-fold RT-PCR amplification reactions is as follows figure 2 shown; based on this, all the primers were mixed to screen for the optimal reaction concentration of each primer. The optimal primer reaction concentration of the 5-fold RT-PCR detection method was finally determined by optimization screening as follows: porcine epidemic diarrhea virus, each 0.3 pmol / µL; porcine transmissible gastroenteritis virus, each 0.05 pmol / µL; porcine rotavirus Viruses, each 1.6 pmol / µL; porcine sapovirus, each 0.2 pmol / µL; porcine crest virus, each 0.2 pmol / µL. The reaction system is: EcoTaq12.5µL, cDNA 5µL, primer mix 7.5µL, ddH 2 O to make up to 25 µL of the total system. The reaction conditions were: 94°C for 4min; 35 cycles of...

Embodiment 3

[0033] Example 3. Specific detection

[0034] Amplify common swine disease pathogens with a defined reaction system and reaction conditions: porcine reovirus, porcine blue ear virus, swine fever virus, porcine pseudorabies virus, foot-and-mouth disease type A virus and foot-and-mouth disease type O virus (the above-mentioned common swine disease pathogens identified before the experiment as image 3 shown), with porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, porcine rotavirus, porcine saapporo virus and porcine crest virus as controls. The results showed that the detection method could only specifically amplify the corresponding fragments of porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, porcine rotavirus, porcine saapporo virus and porcine cristae virus, while porcine reovirus, porcine PRRS virus, swine fever virus, porcine pseudorabies virus, foot-and-mouth disease type A virus and foot-and-mouth disease type O v...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a quintuple RT-PCR detection method and kit for porcine epidemic diarrhea viruses, porcine transmissible gastroenteritis viruses, porcine rotaviruses, porcine sapoviruses and porcine kobuviruses. The kit comprises ten specificity amplification primers. In the using process of the kit, total RNA of a sample to be detected is subjected to reverse transcription to become cDNA through a 6-basic-group random primer, a detection reaction system in the kit is used for RCR amplification with the cDNA as a template, and whether the sample to be detected is infected with one kind of pathogens or is under mixed infection is determined according to different sizes of amplified PCR segments of different pathogens. On the condition of ensuring specificity and sensitivity, the kit has the advantages of being easy and quick to operate and lowering detection cost and labor intensity, and is suitable for field sample detection.

Description

technical field [0001] The invention relates to a detection kit and a method for using the detection kit in non-disease detection. Specifically, the invention is a 5-fold RT-PCR detection kit for porcine viral diarrhea virus and a corresponding method of use. The 5-fold porcine viral diarrhea virus refers to: porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, porcine rotavirus, porcine saapporo virus and porcine crest virus. Background technique [0002] Porcine viral diarrhea is one of the important infectious diseases that seriously endanger the pig industry. The main pathogens causing porcine viral diarrhea are porcine transmissible gastroenteritis virus (TGEV), porcine epidemic diarrhea virus (PEDV), and porcine rotavirus. Virus (RV), etc. In recent years, Sapovirus, Rigivirus and Norovirus have also been detected in pigs with diarrhea and healthy pigs respectively. These viruses are the main pathogens that cause viral diarrhea in pig herds o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/686C12R1/93
CPCC12Q1/686C12Q1/701C12Q2600/16C12Q2537/143C12Q2545/113C12Q2521/107
Inventor 刘光亮李宝玉付钰广陈佳宁兰喜丁光明
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More