Unlock instant, AI-driven research and patent intelligence for your innovation.

Taqman Real-time RT-PCR kit used for detecting sheep pulmonary adenomatosis virus, and use method thereof

An RT-PCR and tumor virus technology, applied in the field of sheep lung adenoma prevention and treatment, can solve the problem of not being able to meet the needs of accurate, rapid and sensitive detection, and achieve the effect of being conducive to rapid detection, helpful for elimination and low cost

Inactive Publication Date: 2016-05-25
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI +1
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The technical problem to be solved by the present invention is to overcome that the prior art cannot adapt to accurate, rapid and sensitive detection requirements, thereby providing a TaqmanReal-timeRT-PCR kit for detecting sheep lung adenoma virus rapidly, sensitively and accurately , the present invention also provides the use method of this kit

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Taqman Real-time RT-PCR kit used for detecting sheep pulmonary adenomatosis virus, and use method thereof
  • Taqman Real-time RT-PCR kit used for detecting sheep pulmonary adenomatosis virus, and use method thereof
  • Taqman Real-time RT-PCR kit used for detecting sheep pulmonary adenomatosis virus, and use method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] 1. Design and preparation of primers

[0040]Search ten strains with reference to GenBank (gene bank), find the conserved region on each sequence through sequence comparison, select the conserved region and design a pair of amplification primers, a probe primer, the sequence is as follows:

[0041] The amplification primer sequences are:

[0042] SEQ ID NO: 1: Upstream primer GAGCTTGCGTGCCGTATCCAT

[0043] SEQ ID NO: 2: downstream primer CGCAAGCCGTAACAGCAGTAGC

[0044] The probe primer sequence is:

[0045] SEQ ID NO: 3: ATGTTGATACAAGGCCATATGGAAATAACGCTGTC The above primers were synthesized and labeled by Dalian Bao Biological Engineering Co., Ltd.

[0046] Positive control: The positive control of the kit of the present invention was constructed and preserved by the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences.

[0047] 2. Make a positive control and its corresponding standard curve

[0048] The positive control is the posi...

Embodiment 2

[0065] Steps 1 and 2 are the same as in Example 1.

[0066] 3. Prepare a kit for detecting 20 heads

[0067] This kit consists of the following components:

[0068] a. OneStepRT-PCR buffer: 250μl;

[0069] b. 60 μl of three primer mixtures with a primer concentration of 10 pmol / μl, including 20 μl of upstream primers, 20 μl of downstream primers, and 20 μl of probe primers;

[0070] c. Enzyme mixture 20μl;

[0071] d. 200 μl of RNA / DNase-free water;

[0072] e. Positive control pGM-JSRV positive plasmid 60μl.

[0073] 4, detect sheep lung adenoma with kit of the present invention

[0074] (1) The total PCR system is 25 μl. OneStepRT-PCRbuffer in the kit of the present invention: 12.5 μl, 3 μl of three primers, 1 μl of enzyme mixture, 5.5 μl of RNA / DNase-free water, 3 μl of RNA template extracted from the sample, 3 μl of positive control pGM-JSRV positive plasmid, and negative control Add 3 μl of DNase-free water to a 0.2ml amplification tube.

[0075] (2) Add 3 μl of p...

Embodiment 3

[0079] Steps 1 and 2 are the same as in Example 1.

[0080] 3. Prepare a kit for detecting 50 heads

[0081] This kit consists of the following components:

[0082] a. OneStepRT-PCR buffer: 625μl;

[0083] b. 150 μl of three primer mixtures with a primer concentration of 10 pmol / μl, including 50 μl of upstream primers, 50 μl of downstream primers, and 50 μl of probe primers;

[0084] c. Enzyme mixture 50μl;

[0085] d. 500 μl of RNA / DNase-free water;

[0086] e. Positive control pGM-JSRV positive plasmid 150μl.

[0087] 4, detect sheep lung adenoma with kit of the present invention

[0088] (1) The total PCR system is 25 μl. OneStepRT-PCRbuffer in the kit of the present invention: 12.5 μl, 3 μl of three primers, 1 μl of enzyme mixture, 5.5 μl of RNA / DNase-free water, 3 μl of RNA template extracted from the sample, 3 μl of positive control pGM-JSRV positive plasmid, and negative control Add 3 μl of DNase-free water to a 0.2ml amplification tube.

[0089] (2) Add 3 μl of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A Taqman Real-time RT-PCR kit used for detecting a sheep pulmonary adenomatosis virus comprises a One Step RT-PCR buffer, an enzyme mixture, a positive control substance, RNA-free enzyme water, and a mixture containing primers with the sequences represented by SEQ ID NO:1 and SEQ ID NO:2 and a probe primer with the sequence represented by SEQ ID NO:3. A detection method disclosed in the invention comprises the step of carrying out RT-PCR amplification by using the kit, and evaluation standards. The method realizes raid, sensitive, accurate and low-cost detection and quantitative analysis of the sheep pulmonary adenomatosis virus. The primers and the probes specifically aiming at the sheep pulmonary adenomatosis virus are designed, and are optimized and assembled to form the kit. Compared with common RT-PCR methods, the method disclosed in the invention has the advantages of time saving, labor saving, and low cost.

Description

technical field [0001] The invention relates to the technical field of prevention and treatment of sheep lung adenoma, specifically a Taqman Real-timeRT-PCR (probe method real-time quantitative reverse transcription-polymerase chain reaction) kit for detecting sheep lung adenoma virus. Also included are methods of using the kit. Background technique [0002] Sheep lung adenomatosis (SPA) is a chronic, progressive, contagious lung tumor disease caused by exogenous D and B type sheep lung adenoma virus (JSRV). The incidence of ovine lung adenomatosis is 50%-80% after first introduction into sensitive flocks. Adult sheep are susceptible and suffer from secondary infectious respiratory diseases, rapid emaciation, and 100% mortality rate after the onset of the disease, which seriously affects the development of the sheep industry worldwide. SPA is mainly distributed locally, and the disease occurs and is popular in the United Kingdom, Germany, France, the Netherlands, Italy, Yu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/686C12Q1/701C12Q2561/113C12Q2561/101C12Q2545/114C12Q2531/113
Inventor 吴锦艳田宏尚佑军陈妍王光祥刘湘涛张志东乔文谭军赵万民
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI