Taqman Real-time RT-PCR kit used for detecting sheep pulmonary adenomatosis virus, and use method thereof
An RT-PCR and tumor virus technology, applied in the field of sheep lung adenoma prevention and treatment, can solve the problem of not being able to meet the needs of accurate, rapid and sensitive detection, and achieve the effect of being conducive to rapid detection, helpful for elimination and low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] 1. Design and preparation of primers
[0040]Search ten strains with reference to GenBank (gene bank), find the conserved region on each sequence through sequence comparison, select the conserved region and design a pair of amplification primers, a probe primer, the sequence is as follows:
[0041] The amplification primer sequences are:
[0042] SEQ ID NO: 1: Upstream primer GAGCTTGCGTGCCGTATCCAT
[0043] SEQ ID NO: 2: downstream primer CGCAAGCCGTAACAGCAGTAGC
[0044] The probe primer sequence is:
[0045] SEQ ID NO: 3: ATGTTGATACAAGGCCATATGGAAATAACGCTGTC The above primers were synthesized and labeled by Dalian Bao Biological Engineering Co., Ltd.
[0046] Positive control: The positive control of the kit of the present invention was constructed and preserved by the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences.
[0047] 2. Make a positive control and its corresponding standard curve
[0048] The positive control is the posi...
Embodiment 2
[0065] Steps 1 and 2 are the same as in Example 1.
[0066] 3. Prepare a kit for detecting 20 heads
[0067] This kit consists of the following components:
[0068] a. OneStepRT-PCR buffer: 250μl;
[0069] b. 60 μl of three primer mixtures with a primer concentration of 10 pmol / μl, including 20 μl of upstream primers, 20 μl of downstream primers, and 20 μl of probe primers;
[0070] c. Enzyme mixture 20μl;
[0071] d. 200 μl of RNA / DNase-free water;
[0072] e. Positive control pGM-JSRV positive plasmid 60μl.
[0073] 4, detect sheep lung adenoma with kit of the present invention
[0074] (1) The total PCR system is 25 μl. OneStepRT-PCRbuffer in the kit of the present invention: 12.5 μl, 3 μl of three primers, 1 μl of enzyme mixture, 5.5 μl of RNA / DNase-free water, 3 μl of RNA template extracted from the sample, 3 μl of positive control pGM-JSRV positive plasmid, and negative control Add 3 μl of DNase-free water to a 0.2ml amplification tube.
[0075] (2) Add 3 μl of p...
Embodiment 3
[0079] Steps 1 and 2 are the same as in Example 1.
[0080] 3. Prepare a kit for detecting 50 heads
[0081] This kit consists of the following components:
[0082] a. OneStepRT-PCR buffer: 625μl;
[0083] b. 150 μl of three primer mixtures with a primer concentration of 10 pmol / μl, including 50 μl of upstream primers, 50 μl of downstream primers, and 50 μl of probe primers;
[0084] c. Enzyme mixture 50μl;
[0085] d. 500 μl of RNA / DNase-free water;
[0086] e. Positive control pGM-JSRV positive plasmid 150μl.
[0087] 4, detect sheep lung adenoma with kit of the present invention
[0088] (1) The total PCR system is 25 μl. OneStepRT-PCRbuffer in the kit of the present invention: 12.5 μl, 3 μl of three primers, 1 μl of enzyme mixture, 5.5 μl of RNA / DNase-free water, 3 μl of RNA template extracted from the sample, 3 μl of positive control pGM-JSRV positive plasmid, and negative control Add 3 μl of DNase-free water to a 0.2ml amplification tube.
[0089] (2) Add 3 μl of...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 