Bacillus licheniformis gene engineering bacterium capable of producing polysaccharide flocculant at high yield and establishment method thereof

A technology of Bacillus licheniformis and genetically engineered bacteria, which is applied in the field of genetic engineering and microbial fermentation, can solve the problems of unclear regulation mechanism and low flocculation activity of polysaccharide flocculants, and achieve the effect of improving flocculation activity and yield

Active Publication Date: 2016-06-01
XIAMEN UNIV
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The object of the present invention is to provide a high-yield polysaccharide flocculant Bacillus licheniformis genetically engineered bacteria and its construction method, and to utilize said Bacillus licheniformis Method for preparing polysaccharide flocculant by genetically engineered bacteria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus licheniformis gene engineering bacterium capable of producing polysaccharide flocculant at high yield and establishment method thereof
  • Bacillus licheniformis gene engineering bacterium capable of producing polysaccharide flocculant at high yield and establishment method thereof
  • Bacillus licheniformis gene engineering bacterium capable of producing polysaccharide flocculant at high yield and establishment method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1: the construction of recombinant expression vector PHY300-epsDEF

[0031] Design PCR primers for amplifying the espDEF gene fragment.

[0032] The upstream and downstream primers are:

[0033] Upstream primer: GGGGTACCATGACAAGAACGGTTTTGT (the underline is the KpnI restriction site)

[0034] Downstream primer: GGACTAGTTCACTGTCCTTCTGCCGC (the underline is the SpeI restriction site)

[0035] Using BacilluslicheniformisCGMCC2876 genomic DNA as a template, perform the following PCR procedures: (1) 94°C, 5min; (2) 94°C, 30s; (3) 55°C, 30s (4) 72°C, 1min, (2)~(4) Repeat step by step for 35 cycles; (5) 72°C, 10min, and store at 4°C.

[0036] The PCR reaction system is shown in Table 1.

[0037] Table 1

[0038]

[0039] The PCR product and the expression vector PHY300PLK-PamyL-TTamyL were double-digested with restriction endonucleases KpnI and SpeI respectively, and after recovery, the PCR product and the expression vector were treated with T4 DNA ligase at...

Embodiment 2

[0040] Embodiment 2: the construction of bacillus licheniformis genetically engineered bacteria HN301-1

[0041] After the PHY300-epsDEF overexpression plasmid was extracted and concentrated, it was transformed into Bacillus licheniformis by electric shock, recovered at 37°C for 5 hours, coated with a tetracycline-resistant plate, and cultured at 37°C for 12 hours to screen transformants. After the transformant was extracted from the plasmid, it was verified by PCR and double enzyme digestion (such as figure 2 and 3 ). Thus, the Bacillus licheniformis engineering strain HN301-1 overexpressing the glycosyltransferase gene epsDEF was obtained.

[0042] The specific steps of electroconversion are as follows:

[0043] Preparation of Bacillus licheniformis competent:

[0044] (1) Inoculate a ring of B. licheniformis in 50mL LB medium, 37°C, 200rmin -1 Cultivate overnight for 12 hours;

[0045] (2) Take 1 mL of the overnight culture solution and put it into 50 mL of the growth ...

Embodiment 3

[0054] Embodiment 3: Utilize Bacillus licheniformis and its genetically engineered bacteria fermentation to prepare polysaccharide flocculant

[0055] Inoculate the Bacillus licheniformis CGMCC2876 starting strain and the genetically engineered bacteria described in Example 2 in the liquid seed medium, 37°C, 200rmin -1 Cultivate for 16 hours, prepare seed culture solution, inoculate in polysaccharide flocculant fermentation medium with an inoculum size of 4% (V / V), 37°C, 200rmin -1 Cultivate and carry out the experiment of producing polysaccharide flocculant by fermentation. After 56 hours, respectively measure the flocculation activity of the fermentation broth and the output of the polysaccharide flocculant, and draw a growth curve (such as Figure 4 and 5 ). The final flocculation activity of the epsDEF gene overexpressed recombinant genetically engineered bacteria fermentation broth was 5332U / mL, which was 90% higher than the final flocculation activity of the original ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a Bacillus licheniformis gene engineering bacterium capable of producing a polysaccharide flocculant at high yield and an establishment method thereof, belonging to the technical fields of gene engineering and microbial fermentation. The gene engineering bacterium is formed by overexpressing epsDEF gene in Bacillus licheniformis. The nucleotide sequence of the epsDEF gene is disclosed as SEQ ID No 1 in the sequence table. The gene engineering bacterium preparation method comprises the following steps: cloning the epsDEF gene into an expression vector to obtain a recombinant expression vector, and transforming the recombinant expression vector into extracellular-polysaccharide-producing Bacillus licheniformis by electric transformation, thereby obtaining the gene engineering bacterium capable of producing a polysaccharide flocculant at high yield. The polysaccharide flocculant preparation method comprises the following steps: carrying out fermentation and culture on the gene engineering bacterium, collecting the fermentation liquid, and purifying to obtain the polysaccharide flocculant. In the gene engineering bacterium fermentation process, the flocculation activity of the fermentation liquid is obviously enhanced, and the polysaccharide flocculant yield is obviously enhanced. The polysaccharide flocculant is applicable to sewage treatment and food engineering.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering and microbial fermentation, and in particular relates to a high-yield polysaccharide flocculant Bacillus licheniformis genetically engineered bacterium and a construction method thereof. Background technique [0002] Microbial flocculant (MBF) is a macromolecular compound secreted by microorganisms that can flocculate and precipitate solid particles, bacteria, cells, and colloids in suspension. The main components are polysaccharides, glycoproteins, proteins, cellulose, and DNA. Wait. Microbial flocculants have the advantages of safety, high efficiency, biodegradability, and no pollution to the environment, and there are many types of microorganisms that can produce flocculants, grow quickly, and are easy to achieve industrialization by engineering means. Therefore, the development prospects of microbial flocculants are very promising. . In the past 20 years, researchers have success...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/54C12N15/75C12N15/66C12P19/04C12R1/10
CPCC12N9/1048C12N15/66C12N15/75C12N2800/101C12P19/04
Inventor何宁陈震余文成王远鹏李清彪沈亮
OwnerXIAMEN UNIV