Engineering bacteria and construction of overexpressing uridine diphosphate glucose pyrophosphorylase gene
A technology of phosphorylase gene and uridine diphosphate, which is applied in genetic engineering, plant genetic improvement, enzymes, etc., can solve the problems of low flocculation activity of polysaccharide flocculants and unclear regulation mechanism, so as to increase production, reduce costs, The effect of improving flocculation activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0030] Example 1: Construction of recombinant expression vector PHY300-gtaB
[0031] Design PCR primers for amplifying the gtaB gene fragment.
[0032] The upstream and downstream primers are:
[0033] Upstream primer: TTGGTACCATGAAAAAAGTAAGAAAAG (the underline is the KpnI restriction site)
[0034] Downstream primer: GGACTAGTTTATATTTCTTCTTTTTATTTAAAAGA (the underline is the SpeI restriction site)
[0035]Using Bacillus licheniformis CGMCC 2876 genomic DNA as a template, perform the following PCR program: (1) 94°C, 5min; (2) 94°C, 30s; (3) 55°C, 30s; (4) 72°C, 1min, step (2) )~(4) Repeat 35 cycles; (5) 72°C, 10min, 4°C storage.
[0036] The PCR reaction system is shown in Table 1.
[0037] Table 1
[0038]
[0039] The PCR product and the expression vector PHY300PLK-PamyL-TTamyL were double-digested with restriction endonuclease Kpn I and SpeI respectively, and after recovery, the PCR product and the expression vector were used in a ratio of (3-5): 1 with T4 DNA ligase...
Embodiment 2
[0040] Embodiment 2: Construction of Bacillus licheniformis genetically engineered bacteria HN301-2
[0041] After the PHY300-gtaB overexpression plasmid was extracted and concentrated, it was transformed into Bacillus licheniformis by electric shock, recovered at 37°C for 5 hours, coated with a tetracycline-resistant plate, and cultured at 37°C for 12 hours to screen transformants. After the transformant was extracted from the plasmid, it was verified by PCR and double enzyme digestion (such as figure 1 ). Thus, the Bacillus licheniformis engineering strain HN301-2 overexpressing the uridine diphosphate glucose pyrophosphorylase gene gtaB was obtained.
[0042] The specific steps of electroconversion are as follows:
[0043] Preparation of Bacillus licheniformis competent:
[0044] (1) Inoculate a ring of B.licheniformis in 50mL LB medium, culture at 37°C, 200r / min overnight for 12h;
[0045] (2) Take 1 mL of the overnight culture solution and put it into 50 mL of the gro...
Embodiment 3
[0054] Embodiment 3: Utilize Bacillus licheniformis and its genetically engineered bacteria fermentation to prepare polysaccharide flocculant
[0055] Bacillus licheniformis CGMCC 2876 starting strain and the genetically engineered bacterium described in Example 2 were inoculated in liquid seed culture medium, 37 ℃, 200r / min cultivated 16h, prepared seed culture liquid, with the inoculum size of 4% (V / V) Inoculate in the polysaccharide flocculant fermentation medium, culture at 37°C, 200r / min, and carry out the experiment of producing polysaccharide flocculant by fermentation. After 56 hours, the flocculation activity of the fermentation broth and the production of the polysaccharide flocculant (such as figure 2 ). The final flocculation activity of the fermented liquid of the gtaB gene overexpressed recombinant genetically engineered bacteria was 4754U / mL, which was 70% higher than the final flocculated activity of the original strain fermented liquid of 2780U / mL; the crude...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



