A kind of esterase phe14 and its coding gene and application

A technology of PHE14 and esterase, applied in application, genetic engineering, plant gene improvement, etc., can solve problems such as expensive esterase and production technology constraints

Active Publication Date: 2019-06-25
SOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Aiming at the disadvantages of expensive esterase and restricted production technology in the prior art, the present invention provides a new esterase PHE14 and its coding gene and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of esterase phe14 and its coding gene and application
  • A kind of esterase phe14 and its coding gene and application
  • A kind of esterase phe14 and its coding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: Design of primers for esterase gene PHE14 and determination of open reading frame boundaries

[0030] Genomic DNA of Pseudomonadaceae oryzihabitans HUP022 was extracted, and after sequencing and verification, the genome was annotated by means of bioinformatics, the esterase gene was analyzed, and the open reading frame of the esterase gene PHE14 was determined. The nucleotide sequence is shown in SEQ ID NO.1, the full length is 645bp (from the start codon to the stop codon), and the amino acid sequence of the esterase PHE14 encoded by it is shown in SEQ ID NO.2, a total of 214 Amino acid, the gene is a brand new esterase gene. According to the sequence of the esterase gene PHE14 obtained from the analysis, the primers were designed as follows: Forward primer: 5′-CAC GAATTC GTGCTGGAATCGCCTAGC-3′, the underlined part is the EcoRI restriction site; reverse primer: 5′-CCG CTCGAG TTATTTTTTGCCGAGACGTGCC 3′, the underlined part is the Xho I restriction site.

Embodiment 2

[0031] Embodiment 2: Cloning and vector construction of esterase gene PHE14

[0032] 2.1PCR amplification

[0033] The primer (forward primer: 5'-CAC GAATTC GTGCTGGAATCGCCTAGC-3′, reverse primer: 5′-CCG CTCGAG TTATTTTTTGCCGAGACGTGCC-3′) was sent to Shanghai Bioengineering Co., Ltd. to synthesize primers. The synthesized primers were diluted to 10 μM with TE, and the total DNA of Pseudomonadaceae oryzihabitans HUP022 extracted was used as a DNA template to establish the reaction shown in Table 1. system:

[0034] Table 1 PCR reaction system

[0035]

[0036] Amplify the esterase gene PHE14 using the following PCR amplification program: a. Denaturation at 94°C for 3 minutes; b. Denaturation at 94°C for 30 s, annealing at 55-65°C for 0.5-1 min, extension at 72°C for 1 min, and 20 cycles; c. 72°C Extend for 10 min and cool to 10°C.

[0037]The PCR product was electrophoresed in 1% agarose gel for 20 min at 120V, and observed in a gel imaging system. The band around 645b...

Embodiment 3

[0047] Embodiment 3: High expression of esterase gene PHE14 in Escherichia coli BL21 (DE3)

[0048] 3.1 Preparation of Escherichia coli BL21(DE3) Competent Cells

[0049] 1. Inject a small amount of Escherichia coli BL21(DE3) into a 5mL LB test tube, shake overnight at 37°C, 250rpm;

[0050] 2. Inoculate the Escherichia coli BL21 (DE3) bacterial solution after overnight shaking culture into a 300ml LB shake flask at an inoculum size of 1% volume ratio, and shake it at 37°C for 3-4h (≥ 300rpm) to obtain the original culture;

[0051] 3. Rapidly cool the cultured shake flask to 0°C in ice water, divide the original culture into ice-precooled centrifuge tubes (50 mL), and place on ice for several minutes;

[0052] 4. Centrifuge at 4000rpm for 10min at 4°C to recover the cells and remove the supernatant;

[0053] 5. Pre-cooled with ice 10mL 0.1M CaCl 2 Resuspend the cells and centrifuge at 4000rpm for 10min at 4°C to recover the cells;

[0054] 6. Repeat 5, use 10mL 0.1M CaCl ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses esterase PHE14 as well as an encoding gene and an application thereof. A novel enzyme gene PHE14 is developed from (Pseudomonadaceae oryzihabitans) HUP022, the whole length is 645bp, and the esterase PHE14 encoded by using the gene contains 214 amino acids. By cloning the esterase gene PHE14 and connecting the gene with an expression vector pET-28a (+) and converting escherichia coli BL21 (DE3), after culture and inducible expression, the recombinant expressed esterase PHE14 can be obtained. The esterase PHE14 can be used for preparing chiral methyl lactate, the esterase PHE14 of recombinant expression is taken as a catalyst, and (S)-methyl lactate of which the optical purity is greater than 99% can be prepared. The esterase PHE14 has very high application values in fields such as biochemical engineering and biological medicines.

Description

technical field [0001] The invention belongs to the fields of biochemical industry and biotechnology, and in particular relates to an esterase PHE14 and its coding gene and application. Background technique [0002] Different enantiomers of chiral drugs often show completely different physiological activities and toxicity. For example, the R-type "reactin" is an analgesic and analgesic for pregnant women, while the S-type "reactin" is teratogenic to the fetus. Role; barbiturate S-(-) isomer has the effect of inhibiting nerve activity, while R-(+) isomer has excitatory effect. Therefore, the synthesis of chiral compounds in the pharmaceutical industry is of great significance. In order to reduce the enantiomers with toxic side effects and reduce their biological activity, the synthesis of optically pure chiral drugs has always been the focus of pharmaceutical research. In addition, due to the huge demand for chiral chemicals in the chemical industry, the synthesis of chiral...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N9/16C12N15/55C12P41/00C12P7/62
CPCC12N9/16C12P7/62C12P41/001
Inventor胡云峰王依龙张云
OwnerSOUTH CHINA SEA INST OF OCEANOLOGY - CHINESE ACAD OF SCI