Check patentability & draft patents in minutes with Patsnap Eureka AI!

Triple fluorescent rt-pcr detection kit with primers, probes for avian influenza virus, Newcastle disease virus and infectious bronchitis virus

A RT-PCR, avian influenza virus technology, applied in the field of biological virus detection, can solve the problems of cumbersome operation, single pathogen and so on

Active Publication Date: 2020-01-14
ZHEJIANG ACAD OF SCI & TECH FOR INSPECTION & QUARANTINE
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Immunological and molecular biological detection methods such as ELISA, RT-PCR, and TaqMan probe fluorescent PCR have been used in the diagnosis of the above-mentioned diseases, but currently they are mainly used for the detection of a single pathogen, and their sensitivity, specificity, and simplicity Both need to be further improved. The judgment of ordinary RT-PCR test results requires gel electrophoresis analysis of the product, which is cumbersome to operate.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Triple fluorescent rt-pcr detection kit with primers, probes for avian influenza virus, Newcastle disease virus and infectious bronchitis virus
  • Triple fluorescent rt-pcr detection kit with primers, probes for avian influenza virus, Newcastle disease virus and infectious bronchitis virus
  • Triple fluorescent rt-pcr detection kit with primers, probes for avian influenza virus, Newcastle disease virus and infectious bronchitis virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1: sample preparation and extraction of viral RNA:

[0059] Aseptically collect chicken throat swabs and internal organs (such as: trachea, lungs, lymph nodes, kidneys, spleen, etc.) Viral RNA was extracted using a column nucleic acid extraction kit from Shanghai Huirui Biotechnology Co., Ltd., and extracted according to the kit instructions.

Embodiment 2

[0060] Example 2: Primers and Probes

[0061] The gene sequences of avian influenza virus, Newcastle disease virus and infectious bronchitis virus from all over the world were downloaded from the NCBI gene bank, and their homology comparisons were carried out. Based on highly specific avian influenza virus M gene sequence (gene sequence number: AY300973), Newcastle disease virus gene M gene (gene sequence number: KR338979), infectious bronchitis virus M gene (gene sequence number: KF188434), use Bioinformatics method According to the principle of primer design, and using the Primer Express design software, several sets of specific primers and fluorescent probes for amplifying the above gene fragments were designed. The designed primers and probes were verified by BLAST (http: / / blast.ncbi.nlm.nih.gov / ) to ensure the high specificity of the primers. Furthermore, DNAStar software was used to verify whether primer-dimers were generated between each primer probe. After the above-...

Embodiment 3

[0065] Embodiment 3: the preparation of plasmid

[0066] Sequence of avian influenza virus positive reference:

[0067] TGAGTCTTTCTAACCGAGGTCGAAACGTACGTTTCTCTCTATCGTCCCATCAGGCCCCCTCAAAGCCGAGATCGCGCAGAGACTTGAAGATGTATTTGCAGGGAAAAATGCAGATCTTGAGGCTCTCATGGAAT.

[0068] Sequence of Newcastle disease virus positive reference:

[0069] GTGATGTGCTCGGACCTTCCGTACTTGTGAAGGCGAGAGGTGCACGGACTAAACTGTTGGCACCTTTCTTCTCTAGCAGTGGGACAGCCTGCTACCCTATAGCAAATGCCTCTCCTCAGGTGGCTAA.

[0070] Sequence of Infectious Bronchitis Virus Positive Reference:

[0071] TGCTATAGAGAGTGTGCCGATGGTGCTTTCTCCTATTATAAAGAATGGTGTTCTTTATTGTGAGGGTCAGTGGCTTGCTAAATGTGAACCAGACCACTTGCCTAAAGACATATTTGTATGCACACCAG.

[0072] According to the above sequence, the positive plasmid of the corresponding virus was constructed artificially, and after construction, the accuracy of the sequence was verified by sequencing, so that three kinds of plasmids each containing one target fragment were obtained.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of detection of biological viruses, in particular to a ternary fluorescence RT-PCR detection kit of avian influenza virus, new castle disease virus and infectious bronchitis virus, primers and probes. The invention relates to avian influenza virus, chicken new castle disease virus and chicken infectious bronchitis virus specific primers and probes. Respective primers and probes are designed on the basis of an avian influenza virus M gene sequence with high specificity, a new castle disease virus M gene and an infectious bronchitis virus M gene, different fluorescence signals are marked on the three probes, and under the condition that a PCR reaction system is optimized, ternary fluorescence quantitative PCR synchronous detection of the avian influenza virus, the chicken new castle disease virus and the chicken infectious bronchitis virus is realized. Early-stage detection rate can be improved, disease propagation is prevented effectively, and economic loss is reduced.

Description

technical field [0001] The invention relates to the field of biological virus detection, in particular to a triple fluorescent RT-PCR detection kit, primers and probes for avian influenza virus, Newcastle disease virus and infectious bronchitis virus. Background technique [0002] Avian influenza virus (AIV) is an influenza A virus belonging to the Orthomyxoviridae family, with pleomorphic virions and envelopes, and a segmented single-stranded negative-sense RNA genome. Newcastle disease virus (NDV) belongs to Paramyxoviridae (Paramyxoviridae) Paramyxovirus genus (Paramyxovirus), virus particles are pleomorphic, with round, oval and long rod shapes, etc., with envelopes, and are ssRNA viruses . Infectious bronchitis virus (IBV) belongs to the genus Coronaviridae of the family Coronaviridae. Most of the virions are round or oval, with envelopes, and the genome nucleic acid is non-segmented positive-strand single-stranded RNA. The above three pathogens are all RNA viruses, w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/686C12N15/11
CPCC12Q1/686C12Q1/701C12Q2537/143C12Q2563/107C12Q2545/114C12Q2531/113
Inventor 何永强曹爱玲帅江冰莫虹斐曾若雪李辉金晨晨门光琦张晓峰余招锋
Owner ZHEJIANG ACAD OF SCI & TECH FOR INSPECTION & QUARANTINE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More