Woody plant stem growth promoting gene TcSG as well as encoded protein and application thereof
A technology of woody plants and uses, applied in the fields of gene technology and botany, can solve the problems of lack of technical means, unsatisfactory growth speed and timber diameter at breast height, and affect the output and quality of poplar wood, so as to promote growth and increase output and quality effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0080] Taxus chinensis peeling treatment and collection of recycled materials
[0081] The plant material of the present invention is the ten-year-old Chinese yew (Taxus chinensis (Pilger) Rehd.) seedlings in the Xiangyang Experimental Base of the Xiangyang Forestry Research Institute of Central Hubei Province. At the beginning of June 2013, during the period of vigorous cambium activity, peeling was carried out, and the yew with good growth and uniform dry shape was taken. The selected yew starts from the base of about 40cm above the ground, and peels it upwards about 25cm. Use a sterile blade to gently scrape the material exposed on the outer trunk after peeling, mark it, and quickly put it into liquid nitrogen , Is the material on the day of peeling, that is, day 0 (day, D). After peeling, wrap the tree with sterile plastic film. On the 6th day after peeling, select the tree that has not been sampled on the 0th day, uncover the plastic film, scrape the material on the trunk ...
Embodiment 2
[0083] Transcriptome sequencing of yew peeled regenerated materials
[0084] According to the CTAB method, the total RNA of the 0D, 6D, 12D, 18D, 24D, 30D and 36D tissues was extracted, and the mRNA was enriched with the magnetic beads with Oligo (dT), and the fragmentation buffer was added to interrupt the mRNA as 200-700 short fragments, using them as templates, respectively use six-base random primers (random hexamers) to synthesize the first cDNA strand, then add buffer, dNTPs, RNase H and DNA polymerase I to synthesize the second cDNA strand . The cDNA was purified with QIAquick PCR Purification Kit (QIAGEN reagent company), eluted with EB buffer, and then repaired, added polyA, and connected the sequencing adapter. The fragments of different sizes were screened by agarose gel electrophoresis, and then amplified by PCR to build the above 7 libraries. Finally, pair-end sequencing was performed with Illumina GAIIx instrument. The original sequencing results removed the adap...
Embodiment 3
[0086] Analysis on the changes of TcSG gene expression level in different periods of Chinese yew peeling and regeneration
[0087] Searching for the transcriptome data of the Chinese yew peeling regeneration tissue obtained by sequencing, the inventors screened and obtained a gene sequence and named it the Chinese yew promoting woody plant stem growth gene (TcSG, Taxus chinensis Stem Growth Gene). The NCBI BLASTx comparison and Open Reading Frame Finder analysis showed that it has a complete open reading frame. According to the sequence of the open reading frame, the following forward and reverse primers are designed:
[0088] Forward primer 5'-3': CCTCCACTTGCAATCCCTAGA (SEQ ID NO: 3)
[0089] Reverse primer 5'-3': CTTGGCTTGAGACAACCAGC (SEQ ID NO: 4)
[0090] Then, real-time quantitative PCR technology was used to analyze the changes in the expression level of this gene in different periods of Chinese yew peeling and regeneration. 600ng RNA extracted from the tissues of yew peeling ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More