Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of male sterility gene OsDPW2 and rice sterility recovery method

A male sterility gene and male sterility technology, applied in the fields of application, genetic engineering, chemical instruments and methods, etc., can solve the limitation of the relationship between the restorer line and the maintainer line, the difficulty of screening excellent combinations, and the superior performance of three-line hybrid rice seeds Complicated problems, to achieve the effect of reducing labor costs and improving production efficiency

Active Publication Date: 2016-10-12
SHANGHAI JIAO TONG UNIV
View PDF1 Cites 44 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the performance of three-line hybrid rice seed dominance is complex, limited by the relationship between the restorer line and the maintainer line, making it difficult to select excellent combinations

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of male sterility gene OsDPW2 and rice sterility recovery method
  • Application of male sterility gene OsDPW2 and rice sterility recovery method
  • Application of male sterility gene OsDPW2 and rice sterility recovery method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Embodiment 1, the method for the creation of rice male sterile lines

[0044] 1.1 Create osdpw2 rice male sterile lines by conventional breeding methods

[0045] The osdpw2 mutant material in this example is obtained from conventional japonica rice variety Wuyujing No. 7 (also known as 9522) through conventional genetic engineering methods.

[0046] Those skilled in the art know that other means such as ray irradiation can also be used to induce mutations in rice conventional varieties, specifically including through 60 The osdpw2 mutant was obtained by Coγ-ray mutagenesis, and the treatment dose was 280Gy (reference method: Chen Liang, Chu Huangwei, Yuan Zheng, et al. 60Isolation and genetic analysis of rice mutants induced by Coγ-Ray radiation[J].Xiamen University Journal: Natural Science Edition, 2006, (S1): 82-85). Backcross the mutagenized mutants for three generations to obtain a stable genetic osdpw2 mutant controlled by a recessive nuclear single gene. The ...

Embodiment 2

[0067] Embodiment 2, the purposes of osdpw2 mutant in rice seed production

[0068] The osdpw2 mutant was used as the male parent to cross the sterile parent in the three-line or two-line cross combination to obtain the F1 generation. In the F2 generation, a plant with both male sterility and sterility characteristics was screened, and the plant was crossed with the maintainer line corresponding to the original sterile parent. In the F2 generation, the plants with both male sterility and sterility characteristics were screened again and crossed with the maintainer line. After multiple generations of cross screening, a new male sterile line was obtained, which was suitable as the female parent in the hybrid combination.

Embodiment 3

[0069] Embodiment 3, the method for recovering osdpw2 mutant male sterility traits

[0070] Transferring the genome nucleotide sequence encoding the OsDPW2 gene into the mutant osdpw2 mutant plant can restore the mutant to the wild-type phenotype.

[0071] Genomic DNA was extracted from leaves of wild-type 9522 seedlings as a template, and primers were used:

[0072] 70025gDNAF (its sequence is shown in SEQ ID NO.7):

[0073] CCATGATTAC GAATTC TATTGCCTGTTTGTGGCTGGAC,

[0074] 70025gDNAR (its sequence is shown in SEQ ID NO.8): ATTCGAGCT GGTCACC GCCGCTTACACGTTACTGTATTGG

[0075] A 5997bp genome sequence fragment of the OsDPW2 gene as shown in SEQ ID NO.6 was amplified;

[0076] Insert the amplified DNA fragment into the binary vector DCAMBIA1301 vector used for transforming rice through the In-Fusion transformation system of Dalian Bao Biology Co., Ltd.; the sequence verification is correct, and the vector is introduced into Agrobacterium tumefaciens by electroporation. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of male sterility gene OsDPW2 and a rice sterility recovery method. OsDPW2 gene is knocked out, changed or inhibited by using the conventional genetic engineering method or on the basis of a CRISPR / Cas9 system, and the expression level of the OsDPW2 gene is reduced in japonica rice background wild type rice, so that a rice male sterility line is obtained. The invention further relates to the rice sterility recovery method, the OsDPW2 gene is amplified by primers, a mutant plant is transformed by a genetic transformation means, and a mutant can be recovered to be in wild phenotype. In a rice nutritional growth period of the rice male sterility line prepared by the invention, abnormal phenotypes do not exist; but in an anther development process of a reproductive growth period, abnormal phenotypes exist. If the male sterility gene OsDPW2 is used in cross breeding, operation of female parent emasculation can be avoided, production efficiency is greatly improved, labor cost is reduced, and the male sterility gene OsDPW2 has important application on agricultural production.

Description

technical field [0001] The invention relates to a method for creating rice strains in the technical field of bioengineering, in particular to an application of the male sterility gene OsDPW2 and a method for restoring rice fertility. Background technique [0002] Rice is an important food crop in the world. About 50% of the world's population uses rice as a staple food. Rice is also a raw material for processing many foods. Due to the small genome of rice and the mature rice transformation system, it can be used as a model plant for monocotyledon research, but the mechanism of rice reproductive development remains to be understood. The discovery and utilization of rice male sterile lines created a new era of rice hybrid breeding and played a huge role in improving rice yield. Due to the disadvantages of unstable fertility and negative cytoplasmic effect of the sterile lines used in the current rice hybridization process, it is of great significance to conduct in-depth resea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82A01H5/00C07K14/415
CPCC07K14/415C12N15/8205C12N15/8216C12N15/8231C12N2810/10C12N2999/007
Inventor 梁婉琪张大兵徐大伟袁政陈明姣罗治靖
Owner SHANGHAI JIAO TONG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More