[0043] Example 1. Method for creating rice male sterile lines
[0044] 1.1 Create osdpw2 rice male sterile lines through conventional breeding methods
[0045] The osdpw2 mutant material in this example was derived from conventional japonica rice variety Wuyujing 7 (also known as 9522) through conventional genetic engineering methods.
[0046] Those skilled in the art know that other methods such as radiation can also be used to mutate conventional rice varieties for mutation. 60 The osdpw2 mutant was obtained by Coγ-ray mutagenesis, and the treatment dose was 280Gy (reference method: Chen Liang, Chu Huangwei, Yuan Zheng, et al. Isolation and genetic analysis of 60Coγ-Ray mutagenic rice mutant[J].Xiamen University Journal: Natural Science Edition, 2006, (S1): 82-85). The mutagenized mutant was backcrossed for three generations to obtain a stable inherited osdpw2 mutant controlled by a recessive nuclear single gene. The osdpw2 mutant was backcrossed to 9522, and the phenotype of all F1 generations was consistent with that of 9522, showing fertility. In the F2 generation population generated after selfing of the F1 generation of the mutant and wild-type cross, the segregation ratio of fertile and sterile plants is about 3:1, indicating that this is a mutant infertility caused by a recessive single gene mutation Phenotype.
[0047] 1.2 Cloning of rice fertility control protein gene OsDPW2
[0048] It is composed of the fertility control protein gene OsDPW2 (its nucleotide sequence is shown in SEQ ID No. 2) and its mutant gene osdpw2 (its nucleotide sequence is shown in SEQ ID No. 9) constructed by the inventor, The rice gene location cloning (map-based cloning or position cloning) population known to those skilled in the art is located within a small genome fragment, such as within 100Kb, according to molecular markers. On this basis, the genomic DNA clone containing the fragment was isolated by conventional methods. After sequencing and further hybridization, it was determined that one of them contained the complete rice male reproductive development control protein OsDPW2.
[0049] The results of the whole nucleotide sequence analysis showed that the full length of the rice male fertility OsDPW2 gene was 2129 bp (SEQ ID NO. 13, including regulatory regions and introns). After software analysis and cDNA cloning, its ORF is shown in SEQ ID NO. 2, which encodes a rice male reproductive development control protein with a full length of 447 amino acids, and its sequence is shown in SEQ ID NO. 1.
[0050] 1.3 Point mutations in rice fertility control protein gene OsDPW2
[0051] The osdpw2 mutant material in this example was obtained from the conventional japonica rice variety Wuyujing 7 (also known as 9522) through the sequence variation of the OsDPW2 gene. After the sequence comparison of the OsDPW2 mutant gene osdpw2, the frameshift of the rice male reproductive development control protein And early termination will make the rice male reproductive organs unable to develop normally, resulting in plant sterility; in this example, the OsDPW2 mutant gene is a base pair deletion in the coding region (the sequence is shown in SEQ ID NO. 9) causing rice males. The translation of reproductive development control proteins has to be terminated prematurely and loses function.
[0052] 1.4 Reduce the expression level of OsDPW2 in rice varieties by CRISPR
[0053] In order to apply the OsDPW2 protein, a vector of OsDPW2 gene CRISPR was constructed (the vector is from Baige Company, article number BGKO3), and wild-type 9522 plants were transformed to reduce the expression of OsDPW2, thereby achieving the purpose of changing the fertility of rice.
[0054] Synthetic single nucleotide sequence primer
[0055] OsDPW2CRISPRUP (SEQ ID No. 3): TGTGTGGCGGCGCCGGCGACGCACTG
[0056] OsDPW2CRISPRDOWN (SEQ ID No. 4): AAACCAGTGCGTCGCCGGCGCCGCCA
[0057] The synthesized single nucleotide sequence is formed into a dimer structure through annealing reaction, and the ligation reaction is carried out with the vector fragment (the vector is from Baige Company, article number BGKO3) to construct a plasmid containing the rice OsDPW2 gene target sequence OsDPW2-BGKO3;
[0058] The Agrobacterium containing OsDPW2-BGKO3 was streaked on a YEB plate containing Kan (50μg/μl) to obtain a single colony. Pick a single colony and inoculate it into 3ml YEB liquid medium containing antibiotics and shake culture overnight at 28°C. On the second day, transfer to 50ml YEB liquid medium containing antibiotics at 1% inoculum, and continue shaking culture at 200rpm to OD 600 When it is about 0.4 to 0.6, the fresh Agrobacterium liquid is centrifuged at 5000 rpm for 5 minutes, collected and resuspended in 1/3 volume of AAM liquid medium, and it can be used to transform various rice receptor materials.
[0059] In this example, a conventional Agrobacterium transformation method was used to transform the callus of rice 9522 immature embryos. Take the 9522 immature seeds 12-15 days after pollination, soak them in 70% ethanol for 1 minute, and sterilize them in sodium hypochlorite solution (mixed with water 1:3, add 2-3 drops of Tween 20) for more than 90 minutes. Rinse with water for 4-5 times, then pick out immature embryos with a scalpel and tweezers and transfer them to N6D2 medium to induce callus, cultivate them at 26±1°C under dark conditions, and can be used for transformation after 4 days. Soak the immature embryo callus in fresh AAM Agrobacterium broth and shake it from time to time. After 20 minutes, remove the rice material, suck up the excess broth on sterile filter paper, and then transfer it to N6D2C medium. Cultivate for 3 days. During co-cultivation, acetosyringone was added to the co-cultivation medium at a concentration of 100 μM. After 3 days, the callus was taken out from the co-cultivation medium, the embryos were cut off and transferred to a selective medium containing 25 mg/L hygromycin for selective culture. After 7-12 days, the resistant callus was transferred to a selection medium containing 50 mg/L Hyg to continue the selection. After 10-12 days, the vigorously growing resistant callus is transferred to the pre-differentiation medium and cultured for about a week, and then transferred to the differentiation medium for differentiation (12 hours light/day). Regenerated seedlings in 1/2MS 0 Root strong seedlings on the H medium, and then move them into the artificial climate chamber for nutrient solution cultivation.
[0060] The total DNA of the leaves was extracted from the positive plants, and the transformed plants were further identified by PCR. Sequencing detects the gene sequence of the target site. If a homozygous mutation occurs, it is an effective gene knockout plant.
[0061] 1.5 Loss of OsDPW2 protein activity or decreased expression level leads to abnormal male development in rice
[0062] Morphological observation of osdpw2 mutant plants. Such as figure 1 The phenotype of wild-type and mutant osdpw2 has no significant difference during the vegetative growth period. During the vegetative growth period, the panicle shape and number of grains per panicle of wild-type and mutant osdpw2 are not significantly different, but the comparison shows that the wild-type 9522 anther development Normal, but osdpw2 mutant anthers become white and smaller (D, E); wild type 9522 iodine staining is normal (F), mutant osdpw2 anther iodine stains mature pollen grains (G).
[0063] 1.6 OsDPW2 expression characteristics
[0064] Using the osdpw2 mutant strain's source parent 9522 each organ and tissue, RNA was extracted, reverse transcription was performed to obtain the first strand of cDNA, and semi-quantitative RT-PCR ( figure 2 A) and fluorescence quantitative PCR method to determine the expression pattern of OsDPW2 gene ( figure 2 B), it is found that OsDPW2 gene is widely expressed in rice, and it is expressed in roots, stems, leaves and anthers at different developmental stages. Stage7 to Stage11 of anthers were significantly expressed during the reproductive development of rice. The OsDPW2 gene self-promoter was fused with the GUS reporter gene, transformed into a wild type, and stained the T1 generation transgenic positive plants. GUS staining analysis showed that it was expressed in Stage 7 to Stage 11 of the anther ( figure 2 C), a semi-thin section of the stained Stage10 anthers showed high expression in the tapetum and microspores of the anthers ( figure 2 D).
[0065] 1.7 Application of OsDPW2 gene in creating male sterile lines of other rice lines
[0066] Crossing the osdpw2 mutant with the indica rice variety 9311, Longtefu or Guangluai No. 4 rice lines, male sterile lines appeared in the plants with indica characteristics in the F2 generation, which conformed to the 3:1 segregation rule, and then It is proved that when the nucleotide sequence of the OsDPW2 gene changes in other rice varieties, it can also produce male sterile plants.
