Method for inducing and quickly propagating hairy roots of tartary buckwheat
A technology of tartary buckwheat and hairy roots, applied in the field of induction and rapid propagation of tartary buckwheat hairy roots, can solve problems such as scattered tartary buckwheat hairy roots, and achieve the effects of short cultivation time, rapid growth and differentiation, and cost saving
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0043] (2) Preparation and pre-cultivation of tartary buckwheat hairy root-induced explants: take 12-15 day-old tartary buckwheat aseptic seedlings, and cut the hypocotyls of tartary buckwheat tissue-cultured seedlings (bottom Hypocotyls were cut into 1cm sections) and cotyledons were used as exogenes for subsequent Agrobacterium infection. Subsequently, the explants were placed in MS medium for pre-cultivation in a light incubator, and the culture conditions were 16 hours of light at 25° C. and 8 hours of darkness at 20° C.
[0044] (3) Configuration of Agrobacterium rhizogenes infection solution: Streak culture of Agrobacterium rhizogenes A4 on YEB solid medium, then place the streaked plate in a constant temperature incubator at 28°C for activation, and then pick a single colony; Then put a single colony in a 1.5mL EP tube with 500μl of YEB culture solution, and place it in a shaker for expansion culture. The culture conditions are 28°C, 200r / min, and culture overnight. Th...
experiment example 2
[0069] Experimental example 2 Molecular detection of the tartary buckwheat hairy roots induced and propagated by the present invention
[0070] 1. Experimental method
[0071] When Agrobacterium rhizogenes infects plants to form hairy roots, the rol gene, together with other genes in the T-DNA, is transferred into the plant genome, and finally induces hairy roots. In order to confirm whether the induced roots are hairy roots, in addition to morphological observation and differentiation, it is also necessary to detect the hairy roots at the molecular level to confirm that the rol gene is inserted into the induced hairy roots; After the hairy root of tartary buckwheat grew to a certain extent, its genomic DNA was extracted, and the rol gene in the T-DNA region of the Agrobacterium rhizogenes Ri plasmid contained in the hairy root was detected by PCR. The primers were designed as follows:
[0072] RolAB-F:ATGGAATTAGCCGGACTAAACG;
[0073] RolAB-R: ATGGATCCCAAATTGCTATTCC;
[007...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap