Method for inducing and quickly propagating hairy roots of tartary buckwheat

A technology of tartary buckwheat and hairy roots, applied in the field of induction and rapid propagation of tartary buckwheat hairy roots, can solve problems such as scattered tartary buckwheat hairy roots, and achieve the effects of short cultivation time, rapid growth and differentiation, and cost saving

Inactive Publication Date: 2016-10-26
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF1 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the research on the induction and tissue culture of tartary buckwheat hairy roots in China is still relatively scattered, and no releva

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for inducing and quickly propagating hairy roots of tartary buckwheat
  • Method for inducing and quickly propagating hairy roots of tartary buckwheat
  • Method for inducing and quickly propagating hairy roots of tartary buckwheat

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0043] (2) Preparation and pre-cultivation of tartary buckwheat hairy root-induced explants: take 12-15 day-old tartary buckwheat aseptic seedlings, and cut the hypocotyls of tartary buckwheat tissue-cultured seedlings (bottom Hypocotyls were cut into 1cm sections) and cotyledons were used as exogenes for subsequent Agrobacterium infection. Subsequently, the explants were placed in MS medium for pre-cultivation in a light incubator, and the culture conditions were 16 hours of light at 25° C. and 8 hours of darkness at 20° C.

[0044] (3) Configuration of Agrobacterium rhizogenes infection solution: Streak culture of Agrobacterium rhizogenes A4 on YEB solid medium, then place the streaked plate in a constant temperature incubator at 28°C for activation, and then pick a single colony; Then put a single colony in a 1.5mL EP tube with 500μl of YEB culture solution, and place it in a shaker for expansion culture. The culture conditions are 28°C, 200r / min, and culture overnight. Th...

experiment example 2

[0069] Experimental example 2 Molecular detection of the tartary buckwheat hairy roots induced and propagated by the present invention

[0070] 1. Experimental method

[0071] When Agrobacterium rhizogenes infects plants to form hairy roots, the rol gene, together with other genes in the T-DNA, is transferred into the plant genome, and finally induces hairy roots. In order to confirm whether the induced roots are hairy roots, in addition to morphological observation and differentiation, it is also necessary to detect the hairy roots at the molecular level to confirm that the rol gene is inserted into the induced hairy roots; After the hairy root of tartary buckwheat grew to a certain extent, its genomic DNA was extracted, and the rol gene in the T-DNA region of the Agrobacterium rhizogenes Ri plasmid contained in the hairy root was detected by PCR. The primers were designed as follows:

[0072] RolAB-F:ATGGAATTAGCCGGACTAAACG;

[0073] RolAB-R: ATGGATCCCAAATTGCTATTCC;

[007...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for inducing and quickly propagating hairy roots of tartary buckwheat. The method includes (1), pre-cultivating sterile explants of the tartary buckwheat; (2), infecting the pre-cultivated explants of the tartary buckwheat by the aid of agrobacterium rhizogene infection liquid; (3), co-cultivating the infected explants; (4), transferring the co-cultivated explants into induction cultivation media and carrying out induction cultivation on the co-cultivated explants; (5), carrying out secondary cultivation and amplification cultivation on the hairy roots of the tartary buckwheat. The hairy roots of the tartary buckwheat are generated by means of induction. The method has the advantages that key parameters such as the explant pre-cultivation time, the agrobacterium rhizogene infection liquid concentration, the infection time, the co-cultivation time and the types of agrobacterium rhizogene which can obviously affect the induction efficiency for the hairy roots of the tartary buckwheat are optimized, accordingly, effects of inducing the hairy roots of the tartary buckwheat can be obviously improved, and the hairy roots of the tartary buckwheat can be quickly and efficiently induced; the method is applicable to inducing hairy roots of different varieties of tartary buckwheat, materials are convenient to obtain, the method is high in applicability and induction speed and easy and convenient to implement, heritance is stable, the cost can be saved, and the like.

Description

technical field [0001] The invention relates to a method for inducing and rapidly multiplying hairy roots of tartary buckwheat, in particular to a method for inducing hairy roots of tartary buckwheat by using Agrobacterium rhizogenes and rapidly multiplying them by tissue culture, which belongs to the hairy roots of tartary buckwheat field of induction and rapid propagation. Background technique [0002] Tartary buckwheat (F. tataricum Gaertn) belongs to Polygonaceae (Polygonaceae), buckwheat (Fagopyrum), is an annual dicotyledonous herb, and is a kind of medicinal and edible plant. Tartary buckwheat originated in China. It has extremely high nutritional and health functions such as benefiting energy, sustaining spirit, benefiting eyes and ears, lowering qi, widening intestines and strengthening stomach. Tartary buckwheat is rich in a variety of vitamins, amino acids, proteins and soluble dietary fiber, as well as a variety of minerals and trace elements, especially it is r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/82A01H5/06
CPCC12N15/8205C12N15/8243
Inventor 周美亮吴燕民邵继荣王成龙丁梦琦
Owner THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap