Primer and method for detecting FII gene 3'UTR sequence
A gene and sequence technology, applied in the field of primers for detecting the 3'UTR sequence of FII gene, can solve the problems of multiple mutation types, high mutation rate, and large capacity of FII gene, achieving high specificity and accuracy, simple operation, and sensitivity high effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Detect the primer of FII gene 3'UTR sequence, comprise: the forward and reverse primer that amplifies coverage detection FII gene 3'UTR sequence; The base sequence of described amplification primer is:
[0034] 20210-F: 5' GCACAGACGGCTGTTCTCTT 3'
[0035] 20210-R: 5' ATAGCACTGGGAGCATTGACGC 3'.
[0036] In the detection, first use the above-mentioned forward and reverse primers to amplify the DNA fragment of the 3'UTR sequence of the FII gene to obtain the amplified product, and then use the above-mentioned sequencing primers to sequence the amplified product to obtain the gene sequence of the amplified product .
[0037] In terms of primer design, each pair of primers designed is located on both sides of the sequence to be amplified, that is, the amplified region includes the entire sequence of the sequence. Although the FII gene has a relatively major mutation site G20210A (on the 3'UTR sequence) in patients with venous thrombosis, there are also many unclear mutatio...
Embodiment 2
[0051] The operation process of blood DNA extraction:
[0052] (1) Genomic DNA extracted from blood:
[0053] 1) Take 500uL of blood and add 1000uL of red blood cell lysate, mix by inversion, and let stand at room temperature for 5 minutes, during which time, invert and mix several times. Centrifuge at 3000rpm for 5min, suck off the supernatant, leave the white blood cell pellet, add 200uL buffer GA, shake until thoroughly mixed.
[0054] 2) Add 20 μl proteinase K solution and mix well.
[0055] 3) Add 200 μl of buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0056] 4) Add 200 μl of absolute ethanol, vortex and mix well for 15 seconds. At this time, flocculent precipitates may appear. Briefly centrifuge to remove water droplets on the inner wall of the tube cap.
[0057] 5) Put the solution and flocculent precipitate obtained in the pr...
Embodiment 3
[0083] Take 24 samples of patients with clinical venous thrombosis, and detect whether there is FII gene mutation in the 24 samples, and the samples are numbered 1-24. The genome was extracted, reagents were prepared and detected according to the methods described in Examples 1 and 2. Add 1 μl of each sample to the detection system PCR reaction solution. At the same time, make positive, negative, and blank controls. Detect with common PCR instrument, the time is 160 minutes.
[0084] Electrophoresis results such as figure 2 As shown, it shows that the primer 20210-F / R of the present invention can effectively amplify blood samples, and the band is single.
[0085] The partial forward sequencing results of the 3'UTR sequence of sample 3 are as follows: image 3 As shown, it is wild type, and no FII mutation was detected.
[0086] The partial forward sequencing results of the 3'UTR sequence of sample 5 are as follows: Figure 4 As shown, it is wild type, and no FII mutatio...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More