Method for expressing protein in resting spores of rhizopus stolonifer

A technology of Rhizopus glucoides and dormant spores, which is applied in the field of expressing proteins in dormant spores of Rhizopus glucoides , can solve problems such as inapplicability, and achieve excellent results with simple and fast steps

Inactive Publication Date: 2016-11-23
FUZHOU UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, whether HDEN electroporation technology can be applied to species other than mammalian cells is still unknown.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for expressing protein in resting spores of rhizopus stolonifer
  • Method for expressing protein in resting spores of rhizopus stolonifer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Expression of green fluorescent protein (GFP) in Rhizopus glucoides cells:

[0067] 1. Plasmid construction

[0068] Using the GFP gene coding sequence, the GFP gene is shown in SEQ ID NO.5,

[0069] The protein sequence of the above GFP gene is shown in SEQ ID NO.6,

[0070] PCR primers for amplifying the GFP gene:

[0071] F: The wavy line is the Aat II restriction site

[0072] R: The wavy line is the Sal I restriction site

[0073] The underlined GCTAGC sequence in primer F is used to promote the binding of the translation initiation factor to RNA after the DNA is transcribed into RNA, and this sequence is adjacent to the initiation codon ATG of the expressed target gene. After using the above pair of primers for PCR, GCTAGC can be carried upstream of the GFP gene, and restriction sites can be carried upstream and downstream.

[0074]

[0075] After agarose gel electrophoresis was used to detect that the PCR product was correct, the PCR product was recov...

Embodiment 2

[0105] Expression of red fluorescent protein (RFP) in Rhizopus glucoides cells:

[0106] 1. Plasmid construction

[0107] The nucleic acid sequence of RFP is shown in SEQ ID NO.7,

[0108] The protein sequence of RFP is shown in SEQ ID NO.8,

[0109] The primers for amplifying the RFP gene are as follows:

[0110] Upstream primer: RFP-F:5'CGGAATTC GCCACC ATGGCCTCCTCCGAGGACGT 3'

[0111] Downstream primer: RFP-R: 5' TCGAGCTCGTTAGGCGCCGGTGGAGTGG 3'

[0112] The 5-end of the upstream primer has an EcoR I restriction site and an underlined GCCACC sequence, which is used to promote the transcription of the DNA into RNA, and the translation initiation factor binds to the RNA. This sequence is consistent with the start codon of the expressed target gene ATG is next door.

[0113] The 5-end of the downstream primer has a Sal I restriction site.

[0114] According to the method of Example 1, the RFP gene was amplified by PCR, molecularly cloned, connected to the pGEM-T easy vect...

Embodiment 3

[0130] Expression of yellow fluorescent protein (YFP) in Rhizopus glucoides cells:

[0131] 1. Plasmid construction

[0132] The nucleic acid sequence of YFP is shown in SEQ ID NO.9,

[0133] The protein sequence of YFP is shown in SEQ ID NO.10,

[0134] Using the same primers as GFP in Example 1, and according to the same experimental steps and methods, the GFP gene was amplified by PCR, molecularly cloned, connected to the pGEM-T easy vector, and then transcribed in vitro, and the resulting RNA was transformed Host spores.

[0135] 2. Using the coding RNA of yellow fluorescent protein to express yellow fluorescent protein in the dormant spores of Rhizopus gluconeoides, the steps are as follows:

[0136] 1) Cultivation of Rhizopus glucoides and collection of spores

[0137] In a 15cm petri dish, prepare a solid agar medium (PDA medium), inoculate Rhizopus glucoides CICC 40325 on the surface of the solid agar medium, and cultivate it for 3 days at a temperature of 40°C and...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for expressing protein in the resting spores of rhizopus stolonifer. The method comprises the following three steps: rhizopus stolonifer culture and spore collection, pretreatment of rhizopus stolonifer spores and electric shock of rhizopus stolonifer spores by using a HDEN method. According to the method, the step of fungal spore germination is avoided, the HDEN electrotransformation technology is adopted, the extracorporeal single-chain coding protein RNA is delivered to penetrate through the cell wall and cell membrane, and the protein is expressed in the resting spores of rhizopus stolonifer. The method disclosed by the invention has simple and quick steps and realizes a perfect effect while the transformation rate exceeds 90%.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for expressing protein in dormant spores of Rhizopus glucoides. Background technique [0002] The central dogma of molecular biology refers to the transfer of genetic information from DNA to RNA, and then from RNA to protein, that is, the process of completing the transcription and translation of genetic information. In modern genetic engineering, hosts are often used to express foreign proteins. The usual method is to construct a plasmid vector, put the coding DNA sequence of the foreign protein behind a strong promoter, and after being introduced into the host cell, the coding DNA sequence is transcribed into mRNA sequence (single-stranded RNA), and the mRNA sequence is expressed into a protein molecule by the translation machinery in the cell, completing the whole process of exogenous protein expression. [0003] Whether as a plasmid free from the host genome...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/87
CPCC12N15/87
Inventor林峻
OwnerFUZHOU UNIV