Check patentability & draft patents in minutes with Patsnap Eureka AI!

Anti-verticillium-wilt associated protein GaRPL18 of cotton and encoding gene and application thereof

A verticillium wilt and coding technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve problems such as difficult to deal with, threats to the sustainable and stable development of cotton production, and long survival time

Active Publication Date: 2017-01-18
INST OF COTTON RES CHINESE ACAD OF AGRI SCI
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

And its fungus survives in the soil for a very long time and is extremely difficult to deal with; it can be said that Verticillium wilt of cotton has become the main biological stress factor leading to the loss of cotton yield, posing a serious threat to the sustainable and stable development of cotton production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-verticillium-wilt associated protein GaRPL18 of cotton and encoding gene and application thereof
  • Anti-verticillium-wilt associated protein GaRPL18 of cotton and encoding gene and application thereof
  • Anti-verticillium-wilt associated protein GaRPL18 of cotton and encoding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0095] Example 1, Cloning and Expression Pattern Analysis of Cotton GaRPL18 Gene

[0096] 1. Mapping of GaRPL18 gene

[0097] 1. Selection of Verticillium wilt research groups

[0098] SSR marker primers were used to analyze the polymorphisms of more than 500 Asian cotton germlines in China, and 215 core germplasm materials that could represent the Asian cotton population in China were selected according to the molecular marker results.

[0099] 2. Acquisition of Asian cotton population genotype

[0100] The DNeasy Plant Mini Kit kit from QIAGEN (Germany) was used to extract the genomic DNA of each individual in the Asian cotton population, build a library, and perform resequencing at a depth of 5 times. The GATAK software was used for population SNP analysis.

[0101] 3. Survey on group Verticillium wilt disease index

[0102] Verticillium dahliae Vd07038 was inoculated on Chapei's medium (NaNO 3 , 2.0g; K 2 PO 4 , 1.0g; KCl, 0.5g; MgSO 4 ·7H 2 O, 0.5g; FeSO 4 , 0.01...

Embodiment 2

[0142] Example 2, the acquisition of GaRPL18 silenced cotton and its disease resistance analysis

[0143] 1. Construction of recombinant vectors and recombinant bacteria

[0144] 1. Construction of CLCrV-GaRPL18 vector

[0145] (1) Primer design:

[0146] VGaRPL18-F: ACTAGTATGAAGCTTTGGGCCACCAA (SEQ ID NO: 10);

[0147] VGaRPL18-R: GGCGCGCCCATAAACAAGTTGGGTTT (SEQ ID NO: 11).

[0148] (2) Use the cDNA of Verticillium wilt disease-resistant material Hunan Changde Tiezi cotton as a template, use the primers designed in step (1) to amplify and obtain the target fragment, connect the pMD-19T vector, transform Escherichia coli DH5α competent cells, and colonies Positive clones were identified by PCR, and their cultures were sequenced. Select the correct clone and extract the plasmid (pMD-19T-GaRPL18-V).

[0149] (3) The pMD-19T-GaRPL18-V and pCLCrVA vectors were double digested with restriction endonucleases Spe I and Asc I, and the small and large fragments were recovered respe...

Embodiment 3

[0177] Example 3, the acquisition and functional verification of transgenic GaRPL18 Arabidopsis

[0178] 1. Obtaining GaRPL18 transgenic Arabidopsis

[0179] 1. Construction of overexpression vector

[0180] (1) Using the complementary DNA (cDNA) synthesized from the total RNA of the disease-resistant material Hunan Changde Tiezi cotton as a template, GaRPL18-F (sequence 4) and GaRPL18-R (sequence 5) were used as primers to amplify the mRNA coding region. And connect it with the pMD-19T vector to obtain an intermediate vector (pMD-19T-GaRPL18) containing the GaRPL18 gene.

[0181] (2) The intermediate vector and the pCAMBIA3300 vector were digested with Xba I and Asc I respectively, and the small fragment (GaRPL18 gene) and the large fragment (linear recombinant vector) were recovered respectively, and ligated with T4 ligase overnight in a water bath at 16°C. A ligation product is obtained. The ligation product was transformed into DH5α competent cells by freeze-thaw metho...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an anti-disease associated protein GaRPL18 and encoding gene and application thereof. The protein is the protein (a) shown as an amino acid sequence 3, (b) the fused protein obtained connecting the terminal N and / or C of the protein shown as the sequence 3 to a label or (c) the protein obtained substituting and / or deleting and / or adding one or more amino acid residues of the amino acid sequence 3 and having the same function. Experiments prove that the verticillium-wilt resisting ability of GaRPL18 silence cotton obtained by adopting a gene silencing technology is reduced, while the GaRPL18 transgene arabidopsis thaliana obtained by adopting an expressing method shows obvious verticillium-wilt resistance. It is indicated that the GaRPL18 participates in the defensive reaction of cotton to pathogenic bacteria and fungi and is the important gene participating in innate immunity reaction of cotton.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a cotton Verticillium wilt resistance-related protein GaRPL18 and its coding gene and application. Background technique [0002] Cotton is the most important fiber crop and one of the most important oil crops in the world, as well as an important strategic material. Its production, circulation, processing and consumption are closely related to the lives of the people, the interests of the majority of cotton farmers and the development of the country, and have an important impact on the national economy. [0003] Cotton verticillium wilt is one of the two most important diseases in cotton production, and it is also the "cancer" in the cotton industry at present. There is no effective measure to prevent and control it. And cotton verticillium wilt may occur during the whole growth period of cotton. The germ directly infects the root system in the soil. The germ penetrates ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/00
CPCC07K14/415C12N15/8218C12N15/8282
Inventor 李付广龚骞杨召恩张朝军张雪妍秦文强鲁丽丽葛晓阳王玉芬王晔
Owner INST OF COTTON RES CHINESE ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More