Cotton verticillium wilt resistance related protein garpl18 and its coding gene and application
A technology that encodes genes and verticillium wilt, which is applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of cotton yield loss, difficult to handle, long survival time, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0095] Example 1, Cloning and Expression Pattern Analysis of Cotton GaRPL18 Gene
[0096] 1. Mapping of GaRPL18 gene
[0097] 1. Selection of Verticillium wilt research groups
[0098] SSR marker primers were used to analyze the polymorphisms of more than 500 Asian cotton germlines in China, and 215 core germplasm materials that could represent the Asian cotton population in China were selected according to the molecular marker results.
[0099] 2. Acquisition of Asian cotton population genotype
[0100] The DNeasy Plant Mini Kit kit from QIAGEN (Germany) was used to extract the genomic DNA of each individual in the Asian cotton population, build a library, and perform resequencing at a depth of 5 times. The GATAK software was used for population SNP analysis.
[0101] 3. Survey on group Verticillium wilt disease index
[0102] Verticillium dahliae Vd07038 was inoculated on Chapei's medium (NaNO 3 , 2.0g; K 2 PO 4 , 1.0g; KCl, 0.5g; MgSO 4 ·7H 2 O, 0.5g; FeSO 4 , 0.01...
Embodiment 2
[0142] Example 2, the acquisition of GaRPL18 silenced cotton and its disease resistance analysis
[0143] 1. Construction of recombinant vectors and recombinant bacteria
[0144] 1. Construction of CLCrV-GaRPL18 vector
[0145] (1) Primer design:
[0146] VGaRPL18-F: ACTAGTATGAAGCTTTGGGCCACCAA (SEQ ID NO: 10);
[0147] VGaRPL18-R: GGCGCGCCCATAAACAAGTTGGGTTT (SEQ ID NO: 11).
[0148] (2) Use the cDNA of Verticillium wilt disease-resistant material Hunan Changde Tiezi cotton as a template, use the primers designed in step (1) to amplify and obtain the target fragment, connect the pMD-19T vector, transform Escherichia coli DH5α competent cells, and colonies Positive clones were identified by PCR, and their cultures were sequenced. Select the correct clone and extract the plasmid (pMD-19T-GaRPL18-V).
[0149] (3) The pMD-19T-GaRPL18-V and pCLCrVA vectors were double digested with restriction endonucleases Spe I and Asc I, and the small and large fragments were recovered respe...
Embodiment 3
[0177] Example 3, the acquisition and functional verification of transgenic GaRPL18 Arabidopsis
[0178] 1. Obtaining GaRPL18 transgenic Arabidopsis
[0179] 1. Construction of overexpression vector
[0180] (1) Using the complementary DNA (cDNA) synthesized from the total RNA of the disease-resistant material Hunan Changde Tiezi cotton as a template, GaRPL18-F (sequence 4) and GaRPL18-R (sequence 5) were used as primers to amplify the mRNA coding region. And connect it with the pMD-19T vector to obtain an intermediate vector (pMD-19T-GaRPL18) containing the GaRPL18 gene.
[0181] (2) The intermediate vector and the pCAMBIA3300 vector were digested with Xba I and Asc I respectively, and the small fragment (GaRPL18 gene) and the large fragment (linear recombinant vector) were recovered respectively, and ligated with T4 ligase overnight in a water bath at 16°C. A ligation product is obtained. The ligation product was transformed into DH5α competent cells by freeze-thaw metho...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


