Method for preparing protein in penicillium expansum hypnospores by use of exogenous RNA

A technology for expanding penicillium and dormant spores, which is applied in the field of protein production, can solve the problems of non-application and achieve the effect of eliminating cathode effect, avoiding killing cells and improving cell survival rate

Inactive Publication Date: 2017-02-08
FUZHOU UNIV
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, whether HDEN electroporation technology can be applied to species other than mammalian cells is still unknown.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing protein in penicillium expansum hypnospores by use of exogenous RNA
  • Method for preparing protein in penicillium expansum hypnospores by use of exogenous RNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Expression of green fluorescent protein (GFP) in Penicillium expanses cells:

[0067] 1. Plasmid construction

[0068] Using the GFP gene coding sequence, the GFP gene is shown in SEQ ID NO.5,

[0069] The protein sequence of the above GFP gene is shown in SEQ ID NO.6,

[0070] PCR primers for amplifying the GFP gene:

[0071] F: AGAT GTGAGCAAGGGC wavy line is Aat II restriction site

[0072] R: ACGC TTACTTGTACAGCTCGT The wavy line is the Sal I restriction site

[0073] The underlined GCTAGC sequence in primer F is used to promote the binding of the translation initiation factor to RNA after the DNA is transcribed into RNA, and this sequence is adjacent to the initiation codon ATG of the expressed target gene. After using the above pair of primers for PCR, GCTAGC can be carried upstream of the GFP gene, and restriction sites can be carried upstream and downstream.

[0074]

[0075] After agarose gel electrophoresis was used to detect that the PCR product was...

Embodiment 2

[0105] Expression of red fluorescent protein (RFP) in Penicillium expanses cells:

[0106] 1. Plasmid construction

[0107] The nucleic acid sequence of RFP is shown in SEQ ID NO.7,

[0108] The protein sequence of RFP is shown in SEQ ID NO.8,

[0109] The primers for amplifying the RFP gene are as follows:

[0110] Upstream primer: RFP-F:5'CGGAATTC ATGGCCTCCTCCGAGGACGT 3'

[0111] Downstream primer: RFP-R: 5' TCGAGCTCGTTAGGCGCCGGTGGAGTGG 3'

[0112] The 5-end of the upstream primer has an EcoR I restriction site and an underlined GCCACC sequence, which is used to promote the transcription of the DNA into RNA, and the translation initiation factor binds to the RNA. This sequence is consistent with the start codon of the expressed target gene ATG is next door.

[0113] The 5-end of the downstream primer has a Sal I restriction site.

[0114] According to the method of Example 1, the RFP gene was amplified by PCR, molecularly cloned, connected to the pGEM-T easy vector, ...

Embodiment 3

[0130] Expression of yellow fluorescent protein (YFP) in Penicillium extensa cells:

[0131] 1. Plasmid construction

[0132] The nucleic acid sequence of YFP is shown in SEQ ID NO.9,

[0133] The protein sequence of YFP is shown in SEQ ID NO.10,

[0134] Using the same primers as GFP in Example 1, and according to the same experimental steps and methods, the GFP gene was amplified by PCR, molecularly cloned, connected to the pGEM-T easy vector, and then transcribed in vitro, and the resulting RNA was transformed Host spores.

[0135] 2. Use the coding RNA of yellow fluorescent protein to express yellow fluorescent protein in the dormant spores of Penicillium expanses, the steps are as follows:

[0136] 1) Extended Penicillium culture and spore collection

[0137] In a 15cm petri dish, prepare a solid agar medium (PDA medium), inoculate Penicillium expanse CICC 40658 on the surface of the solid agar medium, and cultivate it for 3 days at a temperature of 40°C and a humidit...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a method for preparing protein in penicillium expansum hypnospores by use of exogenous RNA. The method comprises the following three steps: penicillium expansum culture and spore collection, penicillium expansum spore pretreatment and electric shock of penicillium expansum by using an HDEN method. According to the method, without a step of fungal spore germination, in-vitro single-stranded encoded protein RNA is delivered to pass the cell wall and cell membrane and express the protein in the penicillium expansum hypnospores. According to the method disclosed by the invention, the steps are simple and fast, the effect is perfect, and the conversion rate exceeds 90%.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a method for producing protein in dormant spores of Penicillium expanses by using exogenous RNA. Background technique [0002] The central dogma of molecular biology refers to the transfer of genetic information from DNA to RNA, and then from RNA to protein, that is, the process of completing the transcription and translation of genetic information. In modern genetic engineering, hosts are often used to express foreign proteins. The usual method is to construct a plasmid vector, put the coding DNA sequence of the foreign protein behind a strong promoter, and after being introduced into the host cell, the coding DNA sequence is transcribed into mRNA sequence (single-stranded RNA), and the mRNA sequence is expressed into a protein molecule by the translation machinery in the cell, completing the whole process of exogenous protein expression. [0003] Whether as a plasmid f...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/80C12R1/83
CPCC12N15/80C12N2800/10
Inventor 林峻
Owner FUZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap