Patents
Literature
PatSnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

65 results about "Penicillium expansum" patented technology

Penicillium expansum is a psychrophilic blue mold that is common throughout the world in soil. It causes Blue Mold of apples, one of the most prevalent and economically damaging post-harvest diseases of apples.

Straw starter and use of the straw starter in straw fermentation

The invention discloses a straw starter. The straw starter comprises Coprinus sterqulinus, penicillium expansum, trichoderma koningii and Coprinopsis atramentaria. The straw starter can be utilized for microbial fermentation of multiple straws of wheat straws and rice straws, is safe and nontoxic, has strong fermentation condition adaptability, allows a wide temperature range, and can be utilizedfor fermentation at an outdoor temperature of 15 to 35 DEG C. Based on different temperatures, fermentation time is in a range of 20 to 80 days. Straws fermented by the straw starter can be utilized as matrixes of biogas, forage and organic fertilizer.
Owner:北海强兴生物科技有限公司

Preparation method of biodiesel from microalgal oil by enzyme method

Belonging to the biochemical field, the invention provides a preparation method of biodiesel from microalgal oil by enzyme method in a novel reaction medium. The method comprises the steps of: (1) providing algae powder made from dried microalgaes; (2) extracting microalgal oil from the algae powder; (3) characterizing the microalgal oil with physiochemical constants, and acquiring a saponification value so as to determine the amount of methanol needed; and (4) with ionic liquid (BMIm)(PF6) or tert-butyl alcohol as the reaction medium, adding methanol which contains alcohol and oil in a ratio ranging from 1:2 to 5:1 by mole into the microalgal oil, and adding 50-400mg penicillium expansum lipase for reaction, thus obtaining fatty acid methyl ester as the product.
Owner:SHENZHEN UNIV

Bacillus subtilis strain and application of antifungal metabolite in grain storage

The invention belongs to the technical field of grain storage, and discloses a bacillus subtilis strain having broad-spectrum antagonism for main grain storage hazard-moulds, a preparation method of an antifungal metabolite of the bacillus subtilis strain, and application of the bacillus subtilis strain and the antifungal metabolite in grain storage. The strain is bacillus subtilis LM3403, and has a preservation number of CGMCC No. 9377. The bacillus subtilis LM3403 has a better inhibiting effect for the main grain storage hazard-moulds such as fusarium graminearum, fusarium moniliforme, aspergillus flavus, aspergillus niger, aspergillus glaucus, aspergillus fumigatus, penicillium oxalicum, penicillium expansum and mucor mucedo, and is wide in antibacterial spectrum, thus having a giant application potential. The antifungal metabolite of the bacillus subtilis LM3403 has an obvious inhibiting effect for the growth of the main grain storage hazard-moulds. The storage test results prove that after the antifungal metabolite of the bacillus subtilis LM3403 is added into stored grains, the growth of the moulds can be effectively inhibited in a grain storage process, so that the grain storage safety is guaranteed.
Owner:HENAN UNIVERSITY OF TECHNOLOGY

Culture medium for producing griseofulvin through fermentation of penicillium expansum and culture method

InactiveCN106480121AGood fermentation processGood control parametersFungiMicroorganism based processesBiotechnologyNitrogen source
The invention relates to a culture medium for producing griseofulvin through fermentation of penicillium expansum and a culture method. A seed culture medium for producing griseofulvin through fermentation of penicillium expansum, a carbon source and a nitrogen source in a fermentation culture medium and the best compatibility proportion are confirmed. With the adoption of the formula of the culture medium and the fermentation control process, the fermentation unit of griseofulvin can be increased, the fermentation cost can be reduced, raw materials and auxiliary materials are reduced to the largest extent, are free of environmental influence and can be sufficiently supplied, and stable and efficient production of griseofulvin is realized.
Owner:宁夏泰瑞制药股份有限公司

Cresol trimer compounds as well as preparation method and application thereof

The invention relates to cresol trimer compounds as well as a preparation method and application thereof. The compounds with novel structure are prepared from Penicillium expansum 091006 separated from a root sample of Excoecaria agallocha which is a mangrove plant. Proved by experiments, the compounds can be used as a cell proliferation inhibitor or antitumor agent.
Owner:OCEAN UNIV OF CHINA +1

A methylotrophic bacillus strain for biocontrol and application thereof

A methylotrophic bacillus strain (Bacillus methylotrophicus) for biocontrol and application thereof are disclosed. The bacterium Bacillus methylotrophicus BCN2 is deposited in the China General Microbiological Culture Collection Center under the accession number CGMCC No: 16443. The invention comprises isolation and culture of the strain and molecular identification of 16S rDNA; effective inhibiting effects of Methylotrophic Bacillus volatiles against common spoilage fungi (Fusarium oxysporum, Staphylococcus aureus, Trichoderma viride, Colletotrichum gloeosporioides, Penicillium expansum) ontwo-zone plate and loquat fruits and the antiseptic application of the volatile matter in loquat storage. The volatile antimicrobial substances produced by Bacillus methylotrophicus (BCN2) could not contact fruit directly, It can be used for preparing biocontrol fresh-keeping agent which can inhibit spoilage fungi such as Fusarium oxysporum, Staphylococcus aureus, Trichoderma viride, Colletotrichum gloeosporioides, Penicillium expansum and so on, and has wide bacteriostasis spectrum.
Owner:ZHEJIANG UNIV

Glucose oxidase gene Glox, protein, pichia pastoris and preparation and application of pichia pastoris

The invention belongs to preparation of new genes and establishment of engineering bacteria, and particularly relates to a glucose oxidase gene Glox and preparation, establishment and application of pichia pastoris. 5c / end ATGAAGCTCCTTGGCCTCC and 3c / end CTAATTAACAGTAGCGTTGTAATC serve as specific primers, penicillium expansum DNA serves as a template, the glucose oxidase Glox gene is obtained through a PCR amplification method, and the pichia pastoris engineering bacteria are successfully established. The problem that currently, a glucose oxidase gene is recombined for heterologous expressionis solved, the full-length gene Glox and a shuttle expression carrier established by the Glox gene are obtained, the gene Glox is further converted into a pichia pastoris X33 strain, and a strain better secretorily expressing glucose oxidase than an original strain is obtained through screening and identification. The method is simple and easy to carry out, the cost is low, and a good foundationis laid for large-scale production of glucose oxidase.
Owner:河北省微生物研究所有限公司 +1

Preparation for preventing and treating post-harvest mycosis of fruits

InactiveCN110037102AReduced postharvest respiration rateReduce weight lossFruits/vegetable preservation by coatingSnow moldByssochlamys
The invention discloses a preparation for preventing and treating post-harvest mycosis of fruits, and belongs to the field of post-harvest fresh-keeping. The preparation consists of 0.08-0.15% boric acid and 0.8-1.2% chitosan oligosaccharide. According to the invention, the boric acid and chitosan oligosaccharide composite preparation has a better bacteriostatic effect on penicillium expansum, byssochlamys and penicillium citrinum. Compared with single treatment of the chitosan oligosaccharide or the boric acid, the chitosan oligosaccharide and the boric acid can generate a synergistic effect,can effectively inhibit the growth of spores and hyphae, and have a better bactericidal effect. In addition, the preparation of the invention obviously improves the hardness of fruits, maintains highcontent of soluble solid matters in the fruits, obviously reduces the incidence rate of the fruits, reduces the occurrence of mildew, improves the fresh-keeping effect, and prolongs the preservationtime.
Owner:SHAOXING UNIVERSITY

Expansion penicillium strain as well as culture method and use thereof

The invention discloses a strain of penicillium expansum F3 and the application of the penicillium expansum F3 in preparing oligo-galactose. The preservation number of the strain is CGMCC No. 2352, a bacterial colony thereof grows rapidly with radiation rills and olive green color, the strain is light pink in the late growth stage, a conidiophore is smooth, broom-shaped branches are not symmetrical, a conidia is burn on a little peduncle with a chain shape, and the conidia takes an ellipsoid shape. Immobilized enzyme which is obtained through taking freeze-thaw whole cells of the strain as an enzyme source and adopting an alginate calcium embedding method is very stable and can be repeatedly used to synthesize the oligo-galactose, and the immobilized enzyme reacts for 11 batches and keeps the output more than 20%. The strain of the invention can be simply cultured, the hereditary property is stable, the method for preparing the immobilized enzyme is convenient, the property of enzyme is stable, the advantages for applying method in industrial production of the oligo-galactose are prominent, and the prospect is optimistic.
Owner:SHANDONG UNIV

Bacillus cereus wettable powder as well as preparation method and applications of bacillus cereus wettable powder

ActiveCN104232518ASolving Room Temperature Storage ProblemsNo harmBiocideBacteriaBacillus cereusPlant disease
The invention relates to the field of microorganisms, and particularly relates to a bacillus cereus wettable powder as well as a preparation method and applications of the bacillus cereus wettable powder. The bacillus cereus wettable powder comprises the following components in percentage by weight: 50-70% of bacillus cereus lyophilized powder, 8-12% of auxiliaries, 0.5-1.5% of a stabilizer, 0.05-0.15% of an ultraviolet protective agent, and the balance of carriers. The bacillus cereus wettable powder is prepared by the following method comprising the following steps: evenly mixing and grinding all the components to obtain powder with meshes of less than or equal to 150, wherein the temperature through the preparation process is held at 0-45DEG C. The bacillus cereus wettable powder plays a good role in inhibiting common fungal diseases such as cryponectria parasitica, stachybotrys atra, fusarium solani, penicillium expansum, colletotrichum gloeosporioides and aspergillus niger during storage of fruits such as Chinese chestnuts, and is non-toxic to human and livestock, and low in cost; and the room-temperature Chinese chestnut storage problem can be well solved, and the storage cost can be lowered.
Owner:WUHAN POLYTECHNIC UNIVERSITY

Preparation method and application of penicillium genetically engineering bacterium

ActiveCN103571861ABreeding goals are clearImprove efficiencyFungiHydrolasesBiotechnologyTryptophan
The invention discloses a preparation method and an application of a penicillium genetically engineering bacterium. The preparation method comprises the following steps: obtaining a hygromycin resistance expression cassette, cloning the hygromycin resistance expression cassette onto a target plasmid so as to obtain a hygromycin resistance recombinant plasmid; respectively cloning a penicillium lipase gene (PEL), a glyceraldehyde-3-phosphate dehydrogenase promoter PgpdP of penicillium expansum and a aspergillus nidulans tryptophan synthetase terminator TtrPC so as to obtain a PEL gene expression cassette driven by a strong promoter; cloning the PEL gene expression cassette to the hygromycin resistance recombinant plasmid, thus obtaining a hygromycin selection marker containing a PEL gene over-expression vector; and converting the over-expression vector into an engineering agrobacterium, and converting the PEL gene expression cassette to a penicillium strain by using an agrobacterium-mediated transformation method, thus obtaining the penicillium genetically engineering bacterium. The penicillium genetically engineering bacterium obtained by the method has strong lipase production capacity; the enzyme activity of the lipase prepared by the penicillium genetically engineering bacterium is 100%-150% higher than that of a starting strain penicillium wild fungus.
Owner:ANHUI LEVEKING BIOTECH CO LTD

Microbial composite bacterial preparation and application thereof to preparation of fermented feed

The invention relates to a microbial composite bacterial preparation and application thereof to preparation of a fermented feed, and belongs to the technical field of biology and the technical field of fermentation. The invention provides a microbial composite bacterial preparation which is high in safety and can effectively inhibit filamentous fungi such as penicillium expansum, aspergillus niger, penicillium roqueforti, penicillium digitatum and the like. The microbial composite bacterial preparation consists of bifidobacterium longum with the preservation number of GDMCC No.60926 and lactobacillus plantarum with the preservation number of CGMCC No.5494; the fermented feed prepared by utilizing the microbial composite bacterial preparation is rich in nutrient, not liable to decay and very high in safety; and the concrete embodiment is that: in the fermented feed prepared by utilizing the microbial composite bacterial preparation, content of mould is 0 CFU / g, and after the fermented feed is placed for 15d at a temperature of 30 DEG C, the content of the mould in the fermented feed prepared by utilizing the microbial composite bacterial preparation is still 0 CFU / g.
Owner:JIANGNAN UNIV

Bifidobacterium adolescentis capable of inhibiting filamentous fungi and application of bifidobacterium adolescentis

The invention discloses bifidobacterium adolescentis capable of inhibiting filamentous fungi and an application of the bifidobacterium adolescentis, and belongs to the technical field of biology. Theinvention provides a bifidobacterium adolescentis CCFM1108 strain, and the strain can inhibit filamentous fungi. Inhibition of filamentous fungi is specifically reflected in that after the strain is co-cultured with penicillium expansum spores, aspergillus niger spores, penicillium roqueforti spores or penicillium digitatum spores, the germination rate of the penicillium expansum spores, aspergillus niger spores, penicillium roqueforti spores or penicillium digitatum spores can be remarkably inhibited within 7 days; and after the fermentation supernatant of the strain is separately co-culturedwith penicillium expansum spores, aspergillus niger spores, penicillium roqueforti spores or penicillium digitatum spores, germination of the penicillium expansum spores, aspergillus niger spores, penicillium roqueforti spores or penicillium digitatum spores can be remarkably inhibited, and the spore germination inhibition rates can reach 99.88+ / -0.66%, 92.23+ / -0.53%, 88.83+ / -0.82% and 99.25+ / -0.62% respectively.
Owner:JIANGNAN UNIV

Method for improving biological control efficacy of antagonistic yeasts for postharvest acidic pathogenic fungi of fruits and vegetables and application

The invention relates to a method for improving the biological control efficacy of antagonistic yeasts for postharvest acidic pathogenic fungi of fruits and vegetables. The method comprises the following steps of (1) activating biocontrol yeasts; and (2) carrying out liquid culture on the activated biocontrol yeasts. The biocontrol yeasts are marine yeasts Rhodosporidium paludigenum Fell&Tallman, and a strain preservation number is IMI 394084; organic acid is added into a culture medium, so that the capacity of the antagonistic yeasts in preventing and controlling the postharvest acidic pathogenic fungi of the fruits and vegetables is improved; the acidic pathogenic fungi include penicillium digitatum, penicillium italicum, penicillium expansum, botrytis cinerea and sclerotinia; and the method can effectively improve the survival rate of the antagonistic yeasts in different organic acid stresses, improves the capacity of the antagonistic yeasts in preventing and controlling postharvest diseases, is safe, efficient, green and pollution-free, conforms to the natural and environment-friendly concept, and is easy for large-scale application due to the high growth and propagation speed of microorganisms.
Owner:TIANJIN UNIVERSITY OF SCIENCE AND TECHNOLOGY

Microorganism derived from Chinese chestnuts and application thereof as well as microbial agent preparation method

The invention relates to the field of a microorganism, and particularly relates to a microorganism derived from Chinese chestnuts and an application thereof as well as a microbial agent preparation method. The microorganism derived from Chinese chestnuts is collected at the China Center for Type Culture Collection (CCTCC) on November 12, 2013 with the CCTCC No. M2013568, and the collection name of the microorganism is bacillus amyloliquefaciens subspecies CMN1308. The microorganism is an endophyte of Chinese chestnuts and has good effects in the terms of preventing and treating Chinese chestnut seed rot caused by at least one of cryponectria parasitica, fusarium solani, stachybotrys atra, penicillium expansum and colletotrichum, serving as a feed additive to promote the growth of animals and improve the immune ability and the like. Compared with the prior art using chemical pesticides for preventing and treating the seed rot, the microorganism does not cause the harm to human health and environmental pollution, and has important environmental protection significance.
Owner:HUANGGANG NORMAL UNIV

Lactobacillus plantarum PC28152 with broad-spectrum fungal inhibition activity and application of lactobacillus plantarum PC28152

The invention provides a lactobacillus plantarum PC28152 with broad-spectrum fungal inhibition activity. The strain is preserved in China General Microbiological Culture Collection Center on July 6, 2020, and the preservation number is CGMCC No.20198. The lactobacillus plantarum PC28152 and the fermentation liquor thereof have the effect of inhibiting fungal activity in a broad spectrum, and particularly have an obvious inhibiting effect on aspergillus flavus, penicillium chrysogenum, penicillium expansum, fusarium moniliforme and cladosporium cladosporioides. When the strain is applied to food preservation and preservation, infection of spoilage fungi to food can be effectively inhibited, and the shelf life of the food is remarkably prolonged.
Owner:完美(广东)日用品有限公司

Penicillium expansum FP2 strain and application thereof

The invention discloses a penicillium expansum strain named as Penicillium expansum FP2, the scientific name is Penicillium expansum FP2, and the preservation number is CCTCC NO:M2014040. The screened penicillium expansum FP2 strain is used for preparation of patulin, during the fermentation step of preparation of the patulin, due to use of an apple culture medium, the content of the patulin in a prepared crude extract is 300 times of the content of the patulin prepared by a potato dextrose agar (PDA) liquid culture medium, and the cost of the product is 1 / 380 of the cost of the product of the same kind of sigma company, and the cost of the product is greatly reduced.
Owner:SHAANXI NORMAL UNIV

Penicillium expansum strain for degrading liquor distillers' grain cellulose

The invention belongs to the field of biotechnology, and relates to a penicillium expansum strain for degrading liquor distillers' grain cellulose. The penicillium expansum strain for degrading liquor distillers' grain cellulose is named penicillium expansum N53. The penicillium expansum N53 provided by the invention can degrade cellulose in liquor distillers' grains into glucose, has the characteristics of high cellulase activity, high conversion rate from cellulose into glucose and the like, greatly improves the utilization rate of the liquor distillers' grains, provides guarantee to follow-up generation of protein feed, and is a liquor distillers' grain cellulose degrading strain with great values in research and development. Few researches are available about fermenting and degrading the liquor distillers' grain cellulose by use of penicillium expansum.
Owner:SHANDONG FOOD & FERMENT IND RES & DESIGN INST

Bacillus subtilis CF-3 and culture method thereof

The invention discloses bacillus subtilis CF-3 with the preservation number being CCTCC No:M 2016125 and a preparation method thereof. Strains are separated from fermented bean curd. The bacillus subtilis is mainly used for controlling postharvest fruit diseases. The bacillus subtilis CF-3 has good inhibition effect on various postharvest fruit disease pathogenic fungi such as tomato botrytis cinerea, strawberry botrytis cinerea, litchi colletotrichum gloeosporiodies, apple valsa mali miyabe et yamada, apple penicillium expansum, peach Monilinia fracticola, jujube phoma pomirum Thum and jujube Alternaria alternata, is broad in antimicrobial spectrum and high in efficacy and has the advantages of being non-toxic to human and livestock, eco-friendly and the like, and besides, the preparation method of the bacillus subtilis CF-3 adopts a simple process, is short in fermentation period and can be applied to postharvest preservation of fruits and vegetables.
Owner:SHANGHAI UNIV

Biocontrol Bacillus thuringiensis strain and application thereof

The invention discloses a biocontrol Bacillus thuringiensis strain and an application thereof. The collection number of Bacillus thuringiensis BCN10 is CGMCC No: 16675. Fermentation liquor of the Bacillus thuringiensis effectively inhibits common loquat surface putrefying fungi (fusarium oxysporum, botryosphaeria parva, trichoderma aureoviride, colletotrichum gloesporioides and penicillium expansum) on a bi-zone flat plate and a loquat fruit. Volatile substances generated by the fermentation liquor are applied to corrosion resistance in loquat storage, natural putrefaction disease time of theloquat fruit can be delayed, and incidence rate is decreased. Volatile antibacterial substances generated by the Bacillus thuringiensis BCN10 can avoid direct contact with the fruit, the fruit is preserved at normal temperature, food storage time is prolonged, and the strain can be used for preparing a biocontrol preservative which is used for inhibiting the putrefying fungi such as the fusarium oxysporum, the botryosphaeria parva, the trichoderma aureoviride, the colletotrichum gloesporioides and the penicillium expansum and has a wide antibacterial spectrum.
Owner:ZHEJIANG UNIV

Application of combination of alginate oligosaccharide and pichia guilliermondii in prevention and control of postharvest penicilliosis of pear fruits and storage and preservation of pear fruits

The invention belongs to the technical field of biological control, and particularly relates to application of combination of alginate oligosaccharide and pichia guilliermondii in prevention and control of postharvest penicilliosis of pear fruits and storage and preservation of the pear fruits. The application comprises the steps of: activating and culturing pichia guilliermondii, centrifuging to obtain thalli, preparing a yeast suspension and an alginate oligosaccharide solution by using sterile water, and mixing the two solutions to obtain a mixed solution; after punching the surfaces of pear fruits, injecting the mixed solution, and injecting an isopyknic penicillium expansum spore suspension after 2 hours, so as to effectively control penicilliosis; or directly and uniformly spraying the mixed solution on the surfaces of the pear fruits, and naturally air-drying, so that the application in prevention and control of the postharvest penicilliosis of the pear fruits and storage and preservation of the pear fruits can be implemented. According to the invention, postharvest penicilliosis and natural rot of the pear fruits can be effectively controlled, so that the loss caused by postharvest diseases of the pear fruits is reduced; and meanwhile, the application has no adverse effect on main quality indexes of the harvested pear fruits, is convenient to operate, safe and environment-friendly, and has remarkable economic benefits and social benefits.
Owner:JIANGSU UNIV

Modified penicillium expansum lipase gene, and construction and expression method thereof

The present invention relates to an efficiently-expressed modified penicillium expansum lipase gene, and a plasmid construction method and a protein expression method of the gene. According to the present invention, an obtained hygromycin resistance expression cassette is cloned on target plasmid to obtain hygromycin resistance recombinant plasmid; a PCR technology is adopted to respectively amplify penicillium lipase gene (PEL), Aspergillus nidulans strong promoter glyceraldehyde-3-phosphate dehydrogenase promoter (PgpdA) and Aspergillus nidulans tryptophan synthetase terminator (TtrpC) to obtain a PEL gene expression cassette driven by a strong promoter, and finally the PEL gene expression cassette is inserted into the hygromycin resistance recombinant plasmid to obtain a PEL gene overexpression vector with a hygromycin screening marker. In addition, the obtained efficiently-expressed lipase gene production plasmid is transformed to obtain gene engineering penicillium with high lipase expression, wherein the expression is efficient and stable, and a plurality of advantages are provided compared to the conventional lipase production method.
Owner:SHENZHEN LEVEKING BIOLOGY ENG

Mixed essential oil fruit fresh keeping agent and fresh keeping method

The invention discloses a mixed essential oil fruit fresh keeping agent, which is prepared from the following raw materials in parts by weight: 2.5 parts of clove essential oil, 2.5 parts of fennel essential oil, 14 parts of emulsifiers, 7.5 parts of co-emulsifiers and 45 parts of water. A fresh keeping method of the mixed essential oil fruit fresh keeping agent is characterized in that pressure pulsation coating treatment is used; fruits are put into the mixed essential oil fruit fresh keeping agent to be completely soaked; the applied pulsation ratio is 25min to 40min, wherein the pulsationratio is a ratio of high pressure maintaining time to low pressure maintaining time; the high pressure is 120 to 180kPa; the low pressure is 0kPa; the soaking time is 1 to 2h; the soaked fruits are boxed; cold storage at 5 to 7 DEG C is performed. Through experiments, the mixed essential oil fruit fresh keeping agent has high inhibition ratio on penicillium expansum, alternaria alternate, botrytiscinereal and geotrichosis; the penicillium expansum, alternaria alternate, botrytis cinereal and geotrichosis can be effectively inhibited; the inhibition rate reaches 94.3 percent, 94.2 percent, 77.3 percent and 41.8 percent.
Owner:河南省亿稼欣生物科技有限公司

Expression equipment for secretory expression of foreign protein by penicillium expansum and genetically engineered bacterium thereof

InactiveCN103757012AEasy to storeEase of DNA manipulationFungiBacteriaBiotechnologyHeterologous
The invention discloses expression equipment for secretory expression of a foreign protein by penicillium expansum and a genetically engineered bacterium thereof. The expression equipment sequentially comprises the following members from 5' to 3': (1) a lipase gene promoter of penicillium expansum; (2) a signal peptide of secretory expression; (3) multiple cloning sites; (4) a terminator of a gene C of aspergillus nidulans tryptophan synthetase. By inserting the foreign gene into the expression equipment, converting into agrobacterium tumefaciens by T-DNA (Transferred-Deoxyribonucleic Acid) and combining with penicillium expansum, the genetically engineered bacterium of penicillium expansum obtained can efficiently secretory-express heterologous genes originated from animals, plants and microorganisms, so that the foreign protein obtained can be produced on a large scale. The penicillium expansum is exuberant to grow, the condition of culture is extensive and cheap, both solid culture and liquid submerged fermentation are feasible, and the extracelluar protein produced is easy to separate and purify, so that the expression equipment is suitable for producing proteins with great industrial demands.
Owner:SHANGHAI JIAO TONG UNIV

Method for preventing and treating penicilliosis of kiwi fruits by virtue of high-energy electron beam radiation

The invention relates to the technical field of prevention and treatment of postharvest diseases of fruits, and specifically relates to a method for preventing and treating penicilliosis of kiwi fruits by virtue of high-energy electron beam radiation. By virtue of treatment of a proper dose of electron beams, the onset time of the penicilliosis of the kiwi fruits is delayed, the diameters of disease speckles are reduced, the disease index is decreased, the rotting rate is decreased, the storage time of fresh fruits at a low temperature is longer, the storage life of the fruits can be obviouslyprolonged, relatively high eating quality is maintained, and the safety is higher. The method adopted by the invention comprises the steps of: artificially inoculating (infecting) normally-harvestedmature kiwi fruits with Penicillium expansum, carrying out airing, flatly paving the kiwi fruits in a radiation tray in a single-layer manner, conveying the radiation tray into a high-energy electronbeam radiation field for radiation, putting the kiwi fruits into plastic bags and after the radiation is finished, and carrying out low-temperature storage.
Owner:NORTHWEST A & F UNIV

Enzymatic resolution method for optical pure 2-amino-2'-hydroxy-1,1'-binaphthyl

The invention provides an enzymatic resolution method for optical pure 2-amino-2'-hydroxy-1,1'-binaphthyl, which belongs to the field of organic compound preparation and is characterized in that the optical pure 2-amino-2'-hydroxy-1,1'-binaphthyl (NOBIN) is prepared by using low-cost and environmental-friendly resign cured penicillium expansum lipase (PEL) as resolution reagents by a hydrolysis and esterification two-step resolution combination method at a high yield in an enantioselectivity way. The method has the advantages that the repeatability is good, enzyme can be repeatedly used, the cost is low, the environment is protected, the energy is saved, and the method is suitable for the mass preparation of the optical pure 2-amino-2'-hydroxy-1,1'-binaphthyl (NOBIN).
Owner:FUJIAN INST OF RES ON THE STRUCTURE OF MATTER CHINESE ACAD OF SCI

Application of luteolin in delaying quality deterioration of harvested fruits

The invention provides application of luteolin in delaying quality deterioration of harvested fruits. Research finds that the luteolin is externally sprayed on the surfaces of cherry fruits, so that the sensory quality and the oxidation resistance can be remarkably improved; defense reaction and anthocyanin synthesis are induced; and thus, senescence is delayed. The luteolin also can inhibit hyphagrowth of botrytis cinerea and penicillium expansum and reduce pathogenicity of botrytis cinerea and penicillium expansum. Research finds that patulin produced by penicillium expansum can cause cancer and teratogenesis, but luteolin can reduce toxin production of penicillium expansum to a certain extent.
Owner:INST OF BOTANY CHINESE ACAD OF SCI

Method of inhibiting penicillium expansum and application of method

The invention discloses a method of inhibiting penicillium expansum and application of the method. The method comprises the step of illuminating the penicillium expansum with light in the growth process of the penicillium expansum, wherein the light is one or more of blue light, green light, red light and yellow light. According to the method provided by the invention, in the growth process of thepenicillium expansum, one or more of the blue light, the green light, the red light and the yellow light are applied to illuminating the penicillium expansum, and the inhibition effect to the penicillium expansum can be realized. The method does not have the radiation pollution risk, is low in cost and simple to operate, does not cause secondary pollution, has relatively high popularization and application value and is particularly suitable for inhibiting growth of the penicillium expansum at places (such as food preservation) needing to inhibit the penicillium expansum.
Owner:HUNAN AGRICULTURAL UNIV

Expression equipment and genetically engineered bacterium for expressing foreign proteins in penicillium expansum cells

InactiveCN103757047AEasy to storeEase of DNA manipulationFungiBacteriaBiotechnologyHeterologous
The invention discloses expression equipment and genetically engineered bacterium for expressing foreign proteins in penicillium expansum cells. The expression equipment comprises the following components from 5' to 3' in sequence: (a) a lipase gene promoter of penicillium expansum; (b) multiple cloning sites; (c) a terminator of an aspergillus nidulans tryptophan synthetase C gene. The penicillium expansum genetically engineered bacterium obtained by inserting the foreign genes into the expression equipment, transforming agrobacterium tumefaciens with T-DNA binary vectors and combining obtained agrobacterium tumefaciens transformants with penicillium expansum can be used for efficiently expressing the foreign proteins derived from animals, plants, microorganisms and the like to produce plenty of foreign proteins from the foreign proteins. Penicillium expansum grows vigorously, is extensive and cheap in culture conditions, can be subjected to solid culture and submerged fermentation, and is suitable for producing proteins in large industrial demand.
Owner:SHANGHAI JIAO TONG UNIV

Safe and efficient special mildewproof preservative for apples and preparation method thereof

The invention relates to a safe and efficient special mildewproof preservative. The safe and efficient special mildewproof preservative comprises a resistance-inducing preservative solution A used before harvest, a magnetic trapping and quality control preservative solution B used after harvest and an antioxidation preservative solution C used at the end of storage. Shallow pathogenic microorganisms of apples are quickly and thoroughly killed by using a thiophanate methyl component in the preservative 7 days before harvest, the pesticide effect is lost at harvest, and the safety is high; and meanwhile, sodium nitroprusside and gibberellin components in the preservative can kill pathogenic bacteria mainly consisting of penicillium expansum and alternaria alternata in a targeted manner before and after harvest, and can induce and enhance the disease resistance of fruit tissue. An Fe3O4<+> chitosan component in the preservative solution B can achieve targeted high-efficiency adsorption and cooperative trapping effects of the pathogenic bacteria. In addition, sodium nitroprusside and 1-methylcyclopropene components contained in the preservation solutions used for fruits before and after harvest activate related enzyme activity and gene expression to induce production of the disease resistance of the fruits by adjusting sucrose metabolism and respiratory metabolism pathways.
Owner:阿克苏优能农业科技股份有限公司