Modified penicillium expansum lipase gene, and construction and expression method thereof

A technology of lipase gene and expanded Penicillium, applied in the field of genetic engineering, can solve the problems of low enzymolysis temperature, low expression efficiency, low lipase activity, etc., and achieve efficient and stable expression

Inactive Publication Date: 2013-04-03
SHENZHEN LEVEKING BIOLOGY ENG
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In addition, the existing lipase-producing bacteria are mainly bacteria and a small amount of fungi, and the lipase produced by some strains of these strains is unstable under medium temperature conditions due to their low optimum enzymolysis temperature It also consumes energy and its application is limited; moreover, the current lipase-producing gene still has the defects of low expression efficiency and instability, and the obtained lipase also has the shortcoming of low activity, which limits the development of lipase. The further promotion and application of

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Modified penicillium expansum lipase gene, and construction and expression method thereof
  • Modified penicillium expansum lipase gene, and construction and expression method thereof
  • Modified penicillium expansum lipase gene, and construction and expression method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Embodiment 1, the construction of overexpression vector

[0045] Take the following steps:

[0046] (1) Utilize restriction endonuclease Sac I, Kpn I hygromycin resistance expression cassette is digested from plasmid PV2+ (such as figure 1 shown), the fragment was recovered by gel, and cloned into the pCAMBIA2300 plasmid (such as figure 2 Shown), the recombinant plasmid pCHAMBIA2302 with hygromycin resistance was obtained (such as image 3 shown); the hygromycin expression cassette can also be derived from any other DNA containing this sequence or directly synthesized, and the plasmid used to construct the PEL gene overexpression vector can also be expressed in filamentous fungi such as pCAMBIA1300 except for pCAMBIA2300 , pCAMBIA3300 and other pCAMBIA series vectors and pHB vectors;

[0047] (2) According to the sequence design primer (forward primer: TG) of the lipase gene PEL (AF330635) of Penicillium expanded ACTAGT ATGTTGTTCAACTACCAATCTTT The underlined sequen...

Embodiment 2

[0053] Embodiment two, the acquisition of Penicillium genetically engineered bacteria

[0054] The activity of described Penicillium genetically engineered bacterium comprises the steps:

[0055] (1) Pick the isolated and purified wild-type Penicillium and inoculate it on a PDA plate, cultivate it at 28°C for about 20 days, and wash the mature spores with sterile water;

[0056] (2) Inoculate the engineered Agrobacterium EHA105 containing the final vector pCHAMBIA2302::PgpdA-PEL-TtrpC in Example 1 in the LB liquid medium containing streptomycin and kanamycin (both 100 μg / ml) at 28°C, Cultivate overnight at 200 rpm, reactivate with MM medium containing streptomycin and kanamycin (both 100 μg / ml), and culture at 220 rpm for 48 hours at 28°C. Take an appropriate amount of culture and centrifuge at 5000rpm to remove the supernatant, wash with 1M liquid medium, and finally dilute to OD600=0.15 with 1M liquid medium, then cultivate at 28°C and 220rpm for 6-8 hours until OD600=0.5- ...

Embodiment 3

[0064] Embodiment 3, comparative experiment of producing lipase ability

[0065] Randomly select the Penicillium genetically engineered bacterium that example 2 gained is inoculated on the PDA medium, insert in the seed culture medium 50mL respectively after cultivating 10 days, at 28 ℃, 210rpm shaker culture 24h, then transfer to respectively with 10% inoculum amount Fermentation medium (30mL fermentation medium in 250mL Erlenmeyer flask) was fermented at 28°C and 210rpm for 48h; then the fermentation broth was centrifuged, and the supernatant was taken for lipase activity detection.

[0066] The lipase activity was detected by acid-base titration.

[0067] step:

[0068]Take 20 100mL Erlenmeyer flasks, add 4.0mL Gly-NaOH buffer solution with pH 9.4 and 5.0mL olive oil emulsion respectively; put them into a oscillating constant temperature water bath at 36°C to preheat for 5 minutes. After filtering the enzyme solution, use 0.05 mol / L Gly-NaOH buffer solution of pH 9.4 was ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to an efficiently-expressed modified penicillium expansum lipase gene, and a plasmid construction method and a protein expression method of the gene. According to the present invention, an obtained hygromycin resistance expression cassette is cloned on target plasmid to obtain hygromycin resistance recombinant plasmid; a PCR technology is adopted to respectively amplify penicillium lipase gene (PEL), Aspergillus nidulans strong promoter glyceraldehyde-3-phosphate dehydrogenase promoter (PgpdA) and Aspergillus nidulans tryptophan synthetase terminator (TtrpC) to obtain a PEL gene expression cassette driven by a strong promoter, and finally the PEL gene expression cassette is inserted into the hygromycin resistance recombinant plasmid to obtain a PEL gene overexpression vector with a hygromycin screening marker. In addition, the obtained efficiently-expressed lipase gene production plasmid is transformed to obtain gene engineering penicillium with high lipase expression, wherein the expression is efficient and stable, and a plurality of advantages are provided compared to the conventional lipase production method.

Description

technical field [0001] The application of the present invention relates to an extended Penicillium lipase gene fragment and its construction and expression method. The lipase gene can be highly expressed and belongs to the technical field of genetic engineering. Background technique [0002] In recent years, lipase (Lipase EC) has made great progress in industrial application. Alkaline lipase is a lipase that hydrolyzes under alkaline conditions. It can hydrolyze natural oils and produce fatty acids and glycerol. An enzyme that hydrolyzes special esters at the oil-water interface of a phase system. Alkaline lipase has the advantages of high substrate hydrolysis efficiency, mild reaction, non-toxicity, and ability to hydrolyze fat under certain conditions. It has been widely used in detergents, papermaking, tanning, food, textile and light industry , and has become an important variety in the enzyme preparation market all over the world. [0003] In the existing technology,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/55C12N9/20C12N15/66C12N15/63
Inventor王剑英陈健王宏兰瑛
OwnerSHENZHEN LEVEKING BIOLOGY ENG