Kit used for SNP detection of personalized medicine relaed genes of statin lipid-lowering medicine and detecting method thereof
A detection method and technology for lipid-lowering drugs, which are applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of high technical operation requirements, poor accuracy and repeatability of chip detection results, and cumbersome results judgment steps. , to solve the expensive effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0069] A kit for guiding the SNP detection of genes related to the individualized medication of statin lipid-lowering drugs, comprising: 2X PCR mixed reaction solution, a primer mix for detecting the rs17238540 site of the HMGCR gene, a primer mix for detecting the rs7412 site of the APOE gene, and a primer mix for detecting APOE Primer mix for gene rs429358 site and primer mix for detection of SLCO1B1 gene rs4149056 site.
[0070] The sequences of two specific forward primers and one reverse primer for detecting the rs17238540 site of the HMGCR gene are as follows:
[0071] G allele forward primer: GAAGGTGACCAAGTTCATGCTCACAATGGATTAGGCTGATATGACC SEQ ID NO.3
[0072] T allele forward primer: GAAGGTCGGAGTCAACGGATTCACAATGGATTAGGCTGATATGACA SEQID NO.4
[0073] Reverse primer: TAATTGGTCTTTTTCCAAACTCTTT SEQ ID NO.5
[0074] The sequences of two specific forward primers and a reverse primer for detecting the APOE gene rs7412 site are as follows:
[0075] C allele forward primer: G...
Embodiment 2
[0088] A PCR amplification method used in a kit for guiding the SNP detection of individualized drug-related genes of statin lipid-lowering drugs comprises the following steps:
[0089] The first step: Genomic DNA extraction of the sample to be tested
[0090] (1) A blood sample is drawn from the patient.
[0091] (2) DNA was obtained from the blood, and the TGuide Blood Genomic DNA Extraction Kit (OSR-M102) produced by Tiangen Biochemical (Beijing) Co., Ltd. was used to extract it on its matching TGuide M16 automatic nucleic acid extraction instrument.
[0092] The extraction process is as follows:
[0093] a. Add 200μl / 400μl mammalian whole blood sample to the sample tube, and add 10μl / 20μl proteinase K to mix well.
[0094] b. Place the sample tube in hole 4 of the T-frame. Run program number 102 (whole blood genomic DNA extraction program), select the corresponding sample volume and final elution volume.
[0095] Step 2: Amplify the DNA
[0096] Using 10ng / 10ul reacti...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



