Agrobacterium and transgenic plant manufacturing method using such agrobacterium

An Agrobacterium, nuclear transfer technology, applied in the fields of botany equipment and methods, biochemical equipment and methods, plant products, etc., can solve the problems of uncontrollable target gene copy number, inconsistent gene expression level, target gene insertion, etc. The effect of improving gene targeting efficiency

Pending Publication Date: 2017-02-22
KANEKA CORP
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] For the currently popular plant transformation technology (Non-Patent Document 1), the target gene cannot be inserted into the target site on the chromosome, not only the target gene is randomly inserted into the chromosome, but also the copy number of the introduced target gene cannot be controlled
Therefore, for the current transformation technology, there are the following problems: for example, the gene expression level caused by the insertion site of the foreign gene is inconsistent, resulting in the so-called "position effect" (Non-Patent Document 2), the insertion of the target gene affects the normal growth The location on the chromosome, the insertion of multiple target genes leads to the inactivation of the target gene
In addition, Patent Document 3 describes that the efficiency of T-DNA delivery by Agrobacterium lacking virE2 is about 10,000 times lower than that of wild-type Agrobacterium and mutant Agrobacterium complemented by transfection (paragraph number 0069)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Agrobacterium and transgenic plant manufacturing method using such agrobacterium
  • Agrobacterium and transgenic plant manufacturing method using such agrobacterium
  • Agrobacterium and transgenic plant manufacturing method using such agrobacterium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0079] [Example 1] Preparation of the gene disruption strain of Agrobacterium

[0080] Agrobacterium A208 strain (C58 chromosome, nopaline (nopaline) type T37pTi) gene disruption The strain was prepared using the "method based on the principle of site-specific insertion by homologous recombination mechanism and shedding by second-stage homologous recombination" described in JP-A-2007-259708.

[0081] The primers used for the preparation of the gene-disrupted strain of Agrobacterium are as follows.

[0082]

[0083]

[0084] In addition, confirmation of gene disruption was carried out by genomic PCR of the prepared Agrobacterium strain. The PCR reaction conditions are shown in Table 2 below.

[0085] Table 2

[0086]

[0087] In addition, the following primers were used for genomic PCR for confirmation of gene disruption.

[0088]

[0089]

[0090] According to the result of genomic PCR, it was confirmed that the target gene had been destroyed in the gene dis...

Embodiment 2

[0091] [Example 2] Confirmation of Pathogenicity (T-DNA Chromosomal Insertion Ability) and T-DNA Nuclear Transfer Ability of Agrobacterium Gene Disruption Strain

[0092] The pathogenicity (T-DNA chromosomal insertion ability) of the Agrobacterium gene-disrupted strain was carried out by the following method. The Agrobacterium gene disruption strain prepared in [Example 1] was inoculated into the leaves of Kalanchoe daigre montiana plants with the bacterium obtained after cultivating the Agrobacterium gene disruption strain at 25° C. for 48 hours with LB solid medium (Difco company). . The presence or absence of pathogenicity (T-DNA chromosomal insertion ability) was judged by the presence or absence of tumor (crown gall) formation at the inoculation site 3 weeks after inoculation. In addition, the strength of pathogenicity was evaluated by comparing the tumor size with that of the Agrobacterium wild strain.

[0093] In addition, confirmation of T-DNA nuclear transfer abilit...

Embodiment 3

[0105] [Example 3] Construction of a gene targeting (homologous recombination) evaluation system using Arabidopsis

[0106]A targeted reporter gene using cruciferin 3 (hereinafter CRU3), which is a seed storage protein of Arabidopsis thaliana, was produced, and a gene targeting evaluation system in dicot Arabidopsis was constructed ( figure 2 ). For the targeting vector used, it can be considered that due to the insertion of GFP fluorescent protein (GFP) inside the CRU3 gene, when the gene targeting is successful, the endosperm, which is the expression site of the CRU3 gene, will emit specific GFP fluorescence.

[0107] In addition, the following primers and PCR reaction conditions in Table 4 were used to confirm the presence or absence of targeting by genomic PCR.

[0108] Forward primer ctacgcgcatgaagatcaag (SEQ ID NO: 82)

[0109] Reverse primer tcctcgcccttgctcaccat (SEQ ID NO: 83)

[0110] Table 4

[0111]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The purpose of the present invention is to provide Agrobacterium with improved gene targeting efficiency. According to the present invention, provided is agrobacterium which includes a T-DNA nuclear transport ability similar to a wild type, and for which the T-DNA chromosome insertion ability is lost or reduced when compared to a wild type.

Description

technical field [0001] The present invention relates to an Agrobacterium with improved gene targeting efficiency and a method for producing a transformed plant using the Agrobacterium. Background technique [0002] For the currently popular plant transformation technology (Non-Patent Document 1), the target gene cannot be inserted into the target site on the chromosome, not only the target gene is randomly inserted into the chromosome, but also the copy number of the introduced target gene cannot be controlled. Therefore, for the current transformation technology, there are the following problems: for example, the gene expression level caused by the insertion site of the foreign gene is inconsistent, resulting in the so-called "position effect" (Non-Patent Document 2), the insertion of the target gene affects the normal growth The location on the chromosome, the insertion of multiple target genes leads to the inactivation of the target gene. Therefore, with the current tran...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20A01H1/00A01H5/00C12N1/21C12N15/09
CPCC12N15/8205
Inventor滨田晴康柳乐洋三田冈直明今井亮三小岛峰雄三木隆二
OwnerKANEKA CORP