Unlock instant, AI-driven research and patent intelligence for your innovation.

Cell surface exhibition PET decomposing enzyme reorganizable pichia pastoris and structure and application

A Pichia pastoris, cell surface technology, applied in the field of genetic engineering of enzymes, can solve the problems of unfavorable large-scale industrial application, low decomposition efficiency, difficult separation and purification, etc.

Active Publication Date: 2017-03-15
TIANJIN UNIV
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] The purpose of the present invention is to overcome the low efficiency of PET decomposing enzymes for PET decomposing enzymes, the difficulty of separation and purification, and the lack of large-scale industrial application, and to provide a high decomposition efficiency and easy separation of PET decomposing enzymes displayed on the cell surface. Recombinant Pichia pastoris

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cell surface exhibition PET decomposing enzyme reorganizable pichia pastoris and structure and application
  • Cell surface exhibition PET decomposing enzyme reorganizable pichia pastoris and structure and application
  • Cell surface exhibition PET decomposing enzyme reorganizable pichia pastoris and structure and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 The construction and application of recombinant Pichia pastoris displaying PET decomposing enzyme on the cell surface, including the following steps:

[0031] chemically synthesized the nucleotide sequence of the improved PET decomposing enzyme shown in SEQ ID No.1;

[0032] Design upstream primer P-F and downstream primer P-R according to the sequence of SEQ ID No.1;

[0033] P-F: 5'-3'CCGCTCGAGAAAAGAGATTACAAGGATGACGACGATAAGCAAAACCAATCCTTATGCCCGTG

[0034] P-R: 5'-3'ACTACCACCTCTCTCCACTACCTCCACCACCGCTACAGTTGGCGGTACGAA

[0035] Perform PCR, and perform 1% agarose gel electrophoresis on the PCR reaction product to recover the target gene fragment to obtain the PET decomposing enzyme gene.

[0036] According to GCW21 (NCBI Reference Sequence: XM_002491407), after predicting its signal peptide, design upstream primer 21-F and downstream primer 21-R;

[0037] 21-F: 5'-3'GGTGGTGGAGGTAGTGGAGGAGGTGGTAGTGACCAGCGAATCTCTGTCAC

[0038] 21-R: 5'-3'CCGGAATTCTTATAACAAAGC...

Embodiment 2

[0110] Example 2 Construction and application of recombinant Pichia pastoris displaying PET decomposing enzyme on the cell surface, including the following steps:

[0111] chemically synthesized the nucleotide sequence of the improved PET decomposing enzyme shown in SEQ ID No.1;

[0112] Design upstream primer P-F and downstream primer P-R according to the sequence of SEQ ID No.1;

[0113] P-F: 5'-3'CCGCTCGAGAAAAGAGATTACAAGGATGACGACGATAAGCAAAACCAATCCTTATGCCCGTG

[0114] P-R: 5'-3'ACTACCACCTCTCTCCACTACCTCCACCACCGCTACAGTTGGCGGTACGAA

[0115] Perform PCR, and perform 1% agarose gel electrophoresis on the PCR reaction product to recover the target gene fragment to obtain the PET decomposing enzyme gene.

[0116] According to GCW51 (NCBI Reference Sequence: XP_002493782), after predicting its signal peptide, design upstream primer 51-F and downstream primer 51-R;

[0117] 51-F: 5'-3'GGTGGTGGAGGTAGTGGAGGAGGTGGTAGTGATGACGATGACTCATTAC

[0118] 51-R: 5'-3'CCGGAATTCCTAGATCAATAGGGCAATG...

Embodiment 3

[0189] Example 3 Construction and application of recombinant Pichia pastoris displaying PET decomposing enzyme on the cell surface, including the following steps:

[0190] chemically synthesized the nucleotide sequence of the improved PET decomposing enzyme shown in SEQ ID No.1;

[0191] Design upstream primer P-F and downstream primer P-R according to the sequence of SEQ ID No.1;

[0192] P-F: 5'-3'CCGCTCGAGAAAAGAGATTACAAGGATGACGACGATAAGCAAAACCAATCCTTATGCCCGTG

[0193] P-R: 5'-3'ACTACCACCTCTCTCCACTACCTCCACCACCGCTACAGTTGGCGGTACGAA

[0194] Perform PCR, and perform 1% agarose gel electrophoresis on the PCR reaction product to recover the target gene fragment to obtain the PET decomposing enzyme gene.

[0195] According to GCW61 (NCBI Reference Sequence: XP_002494322), after predicting its signal peptide, design upstream primer 61-F and downstream primer 61-R;

[0196] 61-F: 5'-3'GGTGGTGGAGGTAGTGGAGGAGGTGGTAGTAACAACCTATCAAACGAGAGT

[0197] 61-R: 5'-3'ATAGTTTAGCGGCCGCTTAAATCA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cell surface exhibition PET decomposing enzyme reorganizable pichia pastoris and structure and application, comprising the structured steps of 1, chemo synthesizing the nucleotide sequence of ameliorated PET decomposing enzyme as shown in SEQ ID No. 1; cloning the nucleotide sequence of anchoring protein gene from the gene group of GS115 pichia pastoris; 2, utilizing the OverlapPCR to connect the nucleotide sequence of anchoring protein gene and the nucleotide sequence of ameliorated PET decomposing enzyme and obtaining an amalgamation sequence; 3, connecting the amalgamation sequence to an expression load of pichia pastoris, and obtaining a reorganizable expression load; 4, transferring the reorganizable expression load in a host pichia pastoris, and obtaining a reorganizable pichia pastoris of a cell surface exhibition PET decomposing enzyme. The reorganizable pichia pastoris can anchor the PET decomposing enzyme to the cell surface, the enzyme after Immobilization can be used for an entire cell catalyst, compared to the wild grow type, has high stability, is convenient to recover, easy to control and can be repeatedly utilized.

Description

technical field [0001] The invention relates to the field of genetic engineering of enzymes, in particular to a recombinant Pichia pastoris displaying PET decomposing enzymes on the cell surface and its construction and application. Background technique [0002] White pollution is a kind of environmental pollution that exists in all cities around the world. It mainly refers to the damage to the environment caused by the plastic waste that people randomly discard in their daily lives, including common plastic cups, disposable lunch boxes, plastic bags, etc. A large part of the white pollutants are PET (polyethylene terephthalate) products. At present, the annual output of PET in the world has reached more than 27 million tons. Although PET will not directly cause harm to the environment, its waste is very resistant to the atmosphere and microorganisms, and its existence cycle in the natural environment is 16-48 In 2009, and with the rapid development of the PET industry, the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12N1/19A62D3/02C12R1/84A62D101/28
CPCA62D3/02A62D2101/28C07K14/37C12N9/14C12N15/81C12N2800/102
Inventor 王泽方杨海涛王雪童善惟陈卓芝程莹莹侯宇佳
Owner TIANJIN UNIV