Preparation method of Alpha-amylase
An amylase and gene technology, applied in the field of α-amylase preparation, can solve the problems of difficulty in obtaining pure products and cumbersome purification steps of α-amylase, and achieve the effect of good safety and simple purification operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
experiment example 1
[0022] Experimental Example 1 Preparation of α-amylase.
[0023] (1) Preparation of vector pxmj19-aph213.
[0024] The structure of the vector pxmj19-aph213 is as figure 1 As shown, its construction process is as follows:
[0025] The aph213 gene was amplified from the vector xk99e vector with primers aph213F and aph213R, and the primers used were as follows:
[0026] aph213F: ccggatatcagcttcacgctgccgcaagcac
[0027] aph213R: ccgaagcttaattctgtttcctgtgtgaaattg
[0028] The PCR conditions are as follows: 95°C for 4min; 35 cycles of 95°C for 30s, 62°C for 30s, and 72°C for 1min; 72°C for 7min.
[0029] The design of the above primers makes the aph213 gene amplification process form an EcoRV cut point upstream of the aph213 gene and a HindIII cut point downstream. Restriction digestion, T4 DNA ligase, and connection to the vector pxmj-19 that has also been digested by EcoRV and HindIII, to obtain the vector pxmj19-aph213.
[0030] The amplification process of the vector pxmj...
Embodiment 2
[0052] Example 2 Identification of alpha-amylases.
[0053] (1) SDS-PAGE identification.
[0054] Centrifuge the fermentation broth, take 10ul of the supernatant for SDS-PAGE, to detect the band size of the protein and the purity of the purification, the results are as follows figure 2 As shown, the results show that compared with the empty vector, the supernatant band with the recombinant α-amylase vector will have an extra band of about 68kD, and the purification result will also have a single band, such as figure 2 As shown, lane 5 is the purified α-amylase, lane 1 is the protein marker, lane 2 is the supernatant of Corynebacterium glutamicum, and lane 3 is the supernatant containing α-amylase that has not been adsorbed after being purified by a nickel column. Flow-through, lane 4 is the supernatant containing α-amylase.
[0055] (2) Identification by DNS method.
[0056] In the experimental group, add 50ul enzyme solution to 250ul pH5.0 citrate disodium hydrogen phosp...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com