Locusta migratoria cytochrome P450 reductase gene dsRNA and application thereof

A technology of cytochrome and reductase, which is applied in the direction of oxidoreductase, DNA/RNA fragments, applications, etc., can solve problems such as the reduction of migratory locust populations, endangering the ecological balance of farmland, and insect disasters

Active Publication Date: 2017-05-10
SHANXI UNIV
View PDF22 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

If the above key gene/lethal gene sequences of migratory locusts are artificially amplified in large quantities during the production process or transferred to crops through plant transgenic means, there is a potential risk of uncontrolled transfer of key genes/lethal genes, which may cause the population of migratory locusts to increase. The sharp d

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Locusta migratoria cytochrome P450 reductase gene dsRNA and application thereof
  • Locusta migratoria cytochrome P450 reductase gene dsRNA and application thereof
  • Locusta migratoria cytochrome P450 reductase gene dsRNA and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1: Acquisition of full-length cDNA of cytochrome P450 reductase gene of migratory locust and prediction of amino acid sequence.

[0018] 1. Bioinformatics search of cytochrome P450 reductase gene in migratory locust.

[0019] The Formatdb program was used to convert the transcriptome Unigene sequence of migratory locusts into an alignment database, and the comparison database and non-redundant protein database were compared and annotated one by one by blastx software, and two cytochrome P450 reductase sequences of migratory locusts were obtained by searching the annotation results.

[0020] 2. The full-length cDNA of cytochrome P450 reductase gene was obtained from migratory locust.

[0021] 2.1) Design of full-length primers required for full-length PCR amplification:

[0022]Using Sequencher software, the two cytochrome P450 reductase genes of migratory locusts were compared and spliced ​​into a full-length sequence; and Oligo software was used to design full...

Embodiment 2

[0029] Example 2: Synthesis of dsRNA from migratory locust cytochrome P450 reductase gene fragment.

[0030] 1. Preparation of templates required for dsRNA synthesis of migratory locust cytochrome gene fragments.

[0031] Based on the DNA sequence SEQ ID NO: 1 of the migratory locust cytochrome P450 reductase gene obtained by sequencing, a pair of primers required for the synthesis of dsRNA was designed using Oligo software; the sequence taatacgactcactatagggg TATGAAATGGGTCTTGGGGA (SEQ ID NO: 5) and taatacgactcactatagggg GGGTGCTTCTTCGTTGACTC (SEQ ID NO: 6) are the upstream and downstream primers required for dsRNA synthesis (the underlined part is the T7 promoter); the designed dsRNA primers were sent to Sangon Bioengineering (Shanghai) Co., Ltd.

[0032] The required primers (both containing the T7 promoter sequence) designed and synthesized for the synthesis of dsRNA were amplified by PCR to obtain a fragment with a length of 519bp; its DNA sequence was the sequence shown ...

Embodiment 3

[0035] Example 3: The cytochrome P450 reductase gene fragment dsRNA of migratory locusts increases the mortality of migratory locusts by carbaryl.

[0036] 1. Injection of dsRNA of cytochrome P450 reductase gene fragment of migratory locust.

[0037] Pick 100 male and female 3rd instar 2nd day nymphs for dsRNA injection. The third-instar nymphs injected with dsGFP were used as the control group, and the dsRNA synthesized by the dsCPR gene fragment was used as the treatment group. A glass needle was used to inject 3 μL (3 μg / nymph) of dsCPR into the second abdominal segment of the migratory locust abdomen, and at the same time, the same number of nymphs were picked and injected with the same amount of dsGFP. After the injection, the two groups of nymphs were placed under the same conditions (light:dark time=14:10 hours, temperature 32±3° C., humidity 50%). Feed sufficient fresh wheat seedlings, oats, and wheat bran.

[0038] 2. Expression detection of cytochrome P450 reducta...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides Locusta migratoria cytochrome P450 reductase gene dsRNA and an application thereof. The nucleotide sequence of the Locusta migratoria cytochrome P450 reductase gene is SEQ ID No.1, based on SEQ ID No.1, a gene fragment SEQ ID No.7 and corresponding dsRNA are designed and synthesized. The designed and synthesized dsRNA is injected into Locusta migratoria body, Locusta migratoria cytochrome P450 reductase gene expression level is reduced, cytochrome P450 reductase enzyme activity is reduced, and fatality of Locusta migratoria due to carbaryl is increased by 1.73 to 2.3 times. The cytochrome P450 gene obtained by screening is used as a molecular target for control of carbaryl resistance, and a new approach is provided for treating carbaryl resistance of Locusta migratoria.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a dsRNA synthesized based on a cytochrome P450 reductase gene fragment and its application in improving the effect of carbaryl in controlling migratory locusts. [0002] technical background [0003] Carbaryl is a carbamate insecticide with a wide range of uses. It has the advantages of low toxicity to humans and animals, good stability, long-lasting drug effect, and rapid onset. It is widely used in various pests of crops and forests. in daily prevention and control work. For a long time, the repeated use of carbamate-based carbamate insecticides to control migratory locusts has caused migratory locusts to develop serious resistance to carbaryl, resulting in increased doses of carbaryl control and increased cost of locust disaster control. Excessive use of carbaryl can also cause potential harm to human health and ecological balance. At present, traditional methods such as mixing p...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/53C12N9/02C12N15/113A01N57/16A01P7/04
CPCA01N57/16C12N9/0081C12N15/1137C12N2310/14C12Y114/15006
Inventor 张学尧王俊秀马恩波张建珍
Owner SHANXI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap