Locusta migratoria cytochrome P450 reductase gene dsRNA and application thereof
A technology of cytochrome and reductase, which is applied in the direction of oxidoreductase, DNA/RNA fragments, applications, etc., can solve problems such as the reduction of migratory locust populations, endangering the ecological balance of farmland, and insect disasters
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Example 1: Acquisition of full-length cDNA of cytochrome P450 reductase gene of migratory locust and prediction of amino acid sequence.
[0018] 1. Bioinformatics search of cytochrome P450 reductase gene in migratory locust.
[0019] The Formatdb program was used to convert the transcriptome Unigene sequence of migratory locusts into an alignment database, and the comparison database and non-redundant protein database were compared and annotated one by one by blastx software, and two cytochrome P450 reductase sequences of migratory locusts were obtained by searching the annotation results.
[0020] 2. The full-length cDNA of cytochrome P450 reductase gene was obtained from migratory locust.
[0021] 2.1) Design of full-length primers required for full-length PCR amplification:
[0022]Using Sequencher software, the two cytochrome P450 reductase genes of migratory locusts were compared and spliced into a full-length sequence; and Oligo software was used to design full...
Embodiment 2
[0029] Example 2: Synthesis of dsRNA from migratory locust cytochrome P450 reductase gene fragment.
[0030] 1. Preparation of templates required for dsRNA synthesis of migratory locust cytochrome gene fragments.
[0031] Based on the DNA sequence SEQ ID NO: 1 of the migratory locust cytochrome P450 reductase gene obtained by sequencing, a pair of primers required for the synthesis of dsRNA was designed using Oligo software; the sequence taatacgactcactatagggg TATGAAATGGGTCTTGGGGA (SEQ ID NO: 5) and taatacgactcactatagggg GGGTGCTTCTTCGTTGACTC (SEQ ID NO: 6) are the upstream and downstream primers required for dsRNA synthesis (the underlined part is the T7 promoter); the designed dsRNA primers were sent to Sangon Bioengineering (Shanghai) Co., Ltd.
[0032] The required primers (both containing the T7 promoter sequence) designed and synthesized for the synthesis of dsRNA were amplified by PCR to obtain a fragment with a length of 519bp; its DNA sequence was the sequence shown ...
Embodiment 3
[0035] Example 3: The cytochrome P450 reductase gene fragment dsRNA of migratory locusts increases the mortality of migratory locusts by carbaryl.
[0036] 1. Injection of dsRNA of cytochrome P450 reductase gene fragment of migratory locust.
[0037] Pick 100 male and female 3rd instar 2nd day nymphs for dsRNA injection. The third-instar nymphs injected with dsGFP were used as the control group, and the dsRNA synthesized by the dsCPR gene fragment was used as the treatment group. A glass needle was used to inject 3 μL (3 μg / nymph) of dsCPR into the second abdominal segment of the migratory locust abdomen, and at the same time, the same number of nymphs were picked and injected with the same amount of dsGFP. After the injection, the two groups of nymphs were placed under the same conditions (light:dark time=14:10 hours, temperature 32±3° C., humidity 50%). Feed sufficient fresh wheat seedlings, oats, and wheat bran.
[0038] 2. Expression detection of cytochrome P450 reducta...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com