Zymomonas mobilis loop-mediated isothermal amplification of DNA rapid detection kit, and detection method
A ring-mediated constant temperature and Zymomonas technology, which is applied in the direction of microbial-based methods, biochemical equipment and methods, and microbial measurement/inspection, to achieve strong specificity, low equipment requirements, and short detection time.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Establishment of rapid detection kit and detection method for ring-mediated constant temperature gene amplification of Zymomonas mobilis
[0026] Step (1), design of primers, assembly of synthetic kits
[0027] The primer sequences determined in this embodiment for detection are as follows:
[0028] Outer primer 1: GTGCAAGATGCGTTGGAAAC,
[0029] Outer primer 2: GGCGTTGATATCGTGATGGA,
[0030] Inner primer 1: GCGATGTTGATCGCACCGTTGT-CTTGTCATCTGCGGTCAGG,
[0031] Inner primer 2: AGCCGGAGCAGAAATCAGAACC-CGGGTATCTTCACCAACACC;
[0032] On this basis, a rapid detection kit for Zymomonas mobilis ring-mediated constant temperature gene amplification is designed, which includes the following reagents:
[0033] (1) Reaction solution 1: composed of 10mmol / L deoxynucleoside triphosphate (dNTP), 10×ThermoPol Buffer reaction buffer, 150mmol / L magnesium sulfate (MgSO 4 ), 5 mol / L betaine and sterilized double distilled water (ddH 2 O) Composition;
[0034] (2) Reaction solution 2:...
Embodiment 2
[0047] negative control
[0048] Step (1), design of primers, assembly of synthetic kits
[0049] The sequence of primers used for detection determined in this embodiment is the same as that in Example 1.
[0050] On this basis, a rapid detection kit for Zymomonas mobilis ring-mediated constant temperature gene amplification is designed, which includes the following reagents:
[0051] (1) Reaction solution 1: composed of 10mmol / L deoxynucleoside triphosphate (dNTP), 10×ThermoPol Buffer reaction buffer, 150mmol / L magnesium sulfate (MgSO 4 ), 5mol / L betaine and sterilized double distilled water (ddH 2 O) Composition;
[0052] (2) Reaction solution 2: composed of 10 μmol / L outer primer 1 (F3), 10 μmol / L outer primer 2 (B3), 40 μmol / L inner primer 1 (FIP) and 40 μmol / L inner primer 2 (BIP);
[0053] (3) 8U / μL Bst DNA polymerase;
[0054] (4) Chromogen: SYBR Green I fluorescent dye with a mass concentration of 10%;
[0055] The reaction solution 1 in the above-mentioned loop-...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
