Construction method and application of schizochytrium limacinum engineering bacteria for KS (Beta-ketoacyl Synthase) gene knockout

A Schizochytrium, gene knockout technology, applied in the construction field of Schizochytrium engineering bacteria, can solve the problem of unclear mechanism of action

Active Publication Date: 2017-05-17
XIAMEN UNIV
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The dehydrogenase gene is one of the key genes for the synthesis of polyunsaturated fatty acids. The PKS gene cluster of Schizochytrium contains multiple dehydrogenase (FabA) sequences, and the FabA genes are involved in the synthesis of polyunsaturated fatty acids. The mechanism of action is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of schizochytrium limacinum engineering bacteria for KS (Beta-ketoacyl Synthase) gene knockout
  • Construction method and application of schizochytrium limacinum engineering bacteria for KS (Beta-ketoacyl Synthase) gene knockout
  • Construction method and application of schizochytrium limacinum engineering bacteria for KS (Beta-ketoacyl Synthase) gene knockout

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Construction of Knockout Recombinant Vector Plasmid pBlu-UKS-Zeo-DKS

[0027] PCR primers were designed to amplify UKS, the upstream fragment of KS gene.

[0028] Forward and reverse primers are:

[0029] Forward primer 1: GGGGTACCCCCCACATCCTACATCGGCAACC (SEQ ID NO 01)

[0030] Reverse primer 2: GCGTCCATGCAGGCGTAAGGTAGCTACC (SEQ ID NO 02)

[0031] PCR primers were designed to amplify the downstream fragment DKS of KS gene.

[0032] Forward and reverse primers are:

[0033] Forward primer 3: CGGGATCCCGCTGCCTAAGGAACTCACTGCT (SEQ ID NO 03)

[0034] Reverse primer 4: CGAAATGCGGCTCTTGGTCTGCTCGAGC (SEQ ID NO 04)

[0035] Using Schizochytrium limacinum ATCC 1381 genomic DNA as a template, perform the following PCR program: (1) 94°C, 5min; (2) 94°C, 30s; (3) 55°C, 30s (4) 72°C, 1min, (2)- (4) Repeat step by step for 35 cycles; (5) Store at 72°C for 10 minutes and at 4°C.

[0036] The PCR reaction system is as follows:

[0037]

[0038] The knockout vector ...

Embodiment 2

[0045] Embodiment 2: Construction of Schizochytrium Genetic Engineering Bacteria SchΔKS

[0046] After extracting and concentrating the pBlu-UKS-Zeo-DKS plasmid, transform Schizochytrium by electric shock, recover at 28°C for 2-3 hours, spread the bleomycin-resistant plate, and culture at 28°C for 3-5d, and select Turn. After the transformant was extracted from the plasmid, it was verified by PCR (such as figure 1 shown). Thus, the recombinant SchΔKS strain of Schizochytrium with KS gene knockout was obtained.

[0047] The specific steps of electroconversion are as follows:

[0048] Preparation of Schizochytrium Competent:

[0049] (1) Inoculate a ring of Schizochytrium limacinum in 20mL seed medium, 28°C, 200r min -1 Cultivate overnight for 48 hours;

[0050] (2) Take 1 mL of the culture solution and put it into 20 mL of the seed medium, at 28°C, 200r min -1 Cultivate to mid-late logarithm for 24 hours;

[0051] (3) Take 5ml of the culture solution at 4°C at 4200r min...

Embodiment 3

[0061] Example 3: Fermentation of polyunsaturated fatty acids by Schizochytrium and its genetically engineered bacteria

[0062] Inoculate the Schizochytrium ATCC1381 starting strain and the genetically engineered bacteria described in Example 2 in the liquid seed medium, 28°C, 200r min -1 Cultivate for 24 hours, prepare seed culture solution, inoculate in unsaturated fatty acid fermentation medium with an inoculum size of 4% (V / V), 28°C, 200r min -1 Cultivate and ferment to produce polyunsaturated fatty acids. After 5 days, the total oil and polyunsaturated fatty acid composition of the fermentation broth were measured respectively (as shown in Table 1). It shows that the keto-synthetase KS plays an important role in the synthesis of unsaturated fatty acids, and the PKS gene cluster contains multiple KS genes. After knocking out a single KS gene, Schizochytrium still has the ability to continue to synthesize polyunsaturated fatty acids.

[0063] Table 1: Comparison of total...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method and application of schizochytrium limacinum engineering bacteria for KS (Beta-ketoacyl Synthase) gene knockout. The construction method comprises the following steps: (1) using a genome of schizochytrium limacinum as a DNA (Deoxyribonucleic Acid) template, and respectively carrying out PCR (Polymerase Chain Reaction) amplification on an upstream fragment UKS and a downstream fragment DKS of a KS gene by using an upstream primer pair and a downstream primer pair; (2) connecting the upstream fragment UKS and the downstream fragment DKS with a knockout carrier, and constructing recombinant knockout plasmids; (3) electrically converting the recombinant knockout plasmids into the schizochytrium limacinum, screening by using a resistant plate, and verifying through a PCR resistant gene sequence, thus obtaining a converter, i.e., the schizochytrium limacinum engineering bacteria for the KS gene knockout. According to the construction method of the schizochytrium limacinum engineering bacteria for the KS gene knockout, provided by the invention, schizochytrium limacinum recombinant bacteria for knocking out FabA (Beta-Hydroxydecanoyl-Acyl Carrier Protein-Dehydratase) genes are constructed; compared with a proportion of total oil and fat in original strains, the polyunsaturated fatty acid production ability of the engineering bacteria is reduced by 43 percent, and the production of C16 and C18 saturated fatty acids is increased by 29 percent.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a method for constructing a ketosynthase gene-knockout Schizochytrium engineering bacterium and an application thereof. Background technique [0002] Polyunsaturated fatty acids (polyunsaturated fatty acids, PUFAs), refers to a class of 18-22 carbon, straight-chain fatty acids containing two or more unsaturated double bonds, play an important role in biological cells, for example, as an important component of cell membrane Divide, store oil, signal transduction and other functions. Currently, PUFAs are divided into n-6 (or ω-6) and n-3 (or ω-3) families. Among these two types of fatty acids, n-3 group polyunsaturated fatty acids include α-Linolenic acid (ALA), Eicosapentaenoic acid (EPA) and Docosahexaenoic acid (Docosahexaenoic Acid). , DHA), n-6 polyunsaturated fatty acids are mainly arachidonic acid (ARA) and linolenic acid (Gamma-Linolenic Acid, GLA). Po...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/80C12P7/64C12R1/645
CPCC12N9/88C12N15/80C12N2800/10C12P7/6427
Inventor何宁李志朋
OwnerXIAMEN UNIV