Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Amplification primer for detecting polymorphism of children's calcium absorption genes and application of amplification primer

A technology of gene polymorphism and amplification primers, which is applied in the detection primers and application fields of nucleotide polymorphisms at the SNP site of FokI, can solve the problems of high cost, poor calcium absorption by children, and difficult separation of hybrids. Type and other problems, to achieve the effect of low false positive and false negative rate, intuitive results and good specificity

Inactive Publication Date: 2017-05-31
天津脉络医学检验有限公司
View PDF3 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The cost of Sanger sequencing is high, and heterozygotes are not easy to type
[0009] At present, there are many calcium supplement products for children on the market, but it is also very important whether children can absorb calcium well after calcium supplementation, so the detection of VDR gene is very important

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Amplification primer for detecting polymorphism of children's calcium absorption genes and application of amplification primer
  • Amplification primer for detecting polymorphism of children's calcium absorption genes and application of amplification primer
  • Amplification primer for detecting polymorphism of children's calcium absorption genes and application of amplification primer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0076] Example 1 Assembling of the kit for detecting polymorphism of calcium absorption genotype in children according to the present invention

[0077] Specifically, the main reagents in the child calcium absorption genotype polymorphism detection kit according to the present invention include:

[0078] (1) PCR amplification reagents: 10× buffer, dNTPs, DNA polymerase, pure water, and PCR amplification primers for detecting FokI (rs2228570) sites, among which,

[0079] FokI (rs2228570) upstream primer (SEQ ID NO. 1): GCGGAACAGCTTGTCCACCC;

[0080] FokI (rs2228570) downstream primer (SEQ ID NO. 2): GCTCAGAACTGCTGGAGTGG.

[0081] (2) Enzyme digestion reagent: RsaI restriction endonuclease and pure water.

Embodiment 2

[0082] Example 2: Detection example of the kit for detecting the genotype polymorphism of calcium absorption in children according to the present invention

[0083] (1) Obtain test samples :

[0084] Choose 5 samples from kindergarten children aged 3-5 years old, take a swab of oral mucosa, wipe the inside of the oral cavity for 20 times, take out the swab, fold off the cotton wool, and place it in 1.5ml of Chelex 100 liquid 150μl by centrifugation Submerge the specimen in the tube, add 20 μL of 20 mg / mL proteinase K in a 50°C water bath overnight, boil for 10 min, place on ice for 3 min, centrifuge at 12000 r / min for 2 min, and take the supernatant to obtain the sample DNA to be tested.

[0085] (2) Testing procedure:

[0086] PCR amplification: using the DNA obtained in step (1) as a template, the PCR amplification primer pair for FokI (rs2228570) site polymorphism in the kit provided in Example 1 is used for PCR amplification. The reaction system is as follows:

[0087]

[0088] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of biological detection medical molecules, and relates to an amplification primer for detecting polymorphism of children's calcium absorption genes and application of the amplification primer, in particular to a detection primer used for polymorphism of a nucleotide at a FokI (rs2228570) SNP site. The amplification primer comprises a specific primer which is designed according to polymorphism of a mononucleotide at a FokI (rs2228570) site. According to the method, a restriction enzyme digestion method adopted to detect a VDR gene is high in accuracy, results are visual, specificity is good and a false positive and false negative rate is low, and therefore, the method is a simple novel method for judging children's calcium absorption. Besides, the PCR amplification primer for detecting polymorphism of children's calcium absorption genes, a detection kit and a detecting method thereof have a very high application value, are simple and convenient to operate, are low in equipment requirement, are wide in adaptation and are especially suitable for being popularized and applied.

Description

Technical field [0001] The invention belongs to the technical field of biological detection of medical molecules, and relates to an amplification primer and application for detecting calcium absorption gene polymorphisms in children, and in particular to a detection of nucleotide polymorphisms at the SNP site of FokI (rs2228570) Primers and applications. Background technique [0002] Calcium is an essential mineral nutrient for the human body, and all cells need calcium. Human health cannot do without calcium. More than 99% of the calcium in the human body is distributed in bones and teeth, half of the remaining 1% is bound to protein, and half is present in soft tissues, extracellular fluid and blood as ions. This part of calcium and bone calcium maintain a dynamic balance, which is necessary for maintaining the normal state of the body. The body has a very powerful mechanism to retain calcium and maintain the calcium concentration in the extracellular fluid, because the phys...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6883C12Q2600/156C12Q2600/172
Inventor 刘鹏飞王菁蕊段婷韩雪
Owner 天津脉络医学检验有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com