Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Loop-mediated isothermal amplification (LAMP) method for detecting pathogenic bacteria of canker disease of carya cathayensis

A hickory dry rot, ring-mediated isothermal technology, applied in the direction of microbial-based methods, biochemical equipment and methods, microbial measurement/inspection, etc., can solve the health hazards of experimenters, difficult access to primers, bromination Ethidium has huge toxicity and other problems, so as to increase the application value, get rid of the dependence on thermal cycle instruments, and achieve the effect of high sensitivity

Active Publication Date: 2017-06-20
ZHEJIANG FORESTRY UNIVERSITY
View PDF3 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the design of primers is not easy to obtain
[0005] In addition, the gel electrophoresis of the product by ordinary PCR reaction can easily cause product amplification, which is a major source of laboratory pollution; moreover, ethidium bromide (EB) is highly toxic, can accumulate and cause cancer, and cause great harm to the human body; Long-term observation of ultraviolet light will also cause a certain degree of damage to the health of experimenters

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Loop-mediated isothermal amplification (LAMP) method for detecting pathogenic bacteria of canker disease of carya cathayensis
  • Loop-mediated isothermal amplification (LAMP) method for detecting pathogenic bacteria of canker disease of carya cathayensis
  • Loop-mediated isothermal amplification (LAMP) method for detecting pathogenic bacteria of canker disease of carya cathayensis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Embodiment 1. A ring-mediated isothermal amplification kit for detecting pecan dry rot pathogens, including loop-mediated isothermal amplification primers for detecting pecan dry rot pathogens,

[0057] The LAMP primer composition consists of the following 4 primers:

[0058] Upstream outer primer (F3): 5'—CGCGTTCAGAAAGATTGCCATA—3';

[0059] Downstream outer primer (B3): 5'—TTGTTGCCAAAACACCCGC—3';

[0060] Upstream inner primer (FIP): 5'—GCGTGGGAGAACATCAATGAC-GCTCGAGCTGAAGGTCCG—3';

[0061] Downstream internal primer (FIB): 5'-CTTACACGCCAGAGCCGT-AACGCGAATCGACACCACAG-3'.

[0062] The kit contains: 10×ThermoPol Buffer, 1mM dNTPs, 4mM MgCl 2 , 0.6mM betaine, 150μM hydroxynaphthol blue (HNB), 8U / μL Bst DNA polymerase, ddH 2 O, 1.6 μM forward inner primer FIP, 1.6 μM reverse inner primer BIP, 0.2 μM forward outer primer F3, 0.2 μM reverse outer primer B3.

[0063] The 25 μL reaction system used in the experiment was prepared from the following ingredients: 8U / μL Bst DNA...

Embodiment 2

[0065] Embodiment 2, a kind of ring-mediated isothermal amplification method that is used to detect hickory dry rot pathogen:

[0066] Use the 25 μL detection reaction system to carry out the LAMP amplification reaction, and choose any of the following methods:

[0067] Method 1. Add the dye hydroxynaphthol blue (HNB) as a reaction indicator before the amplification, and use the color change of hydroxynaphthol blue (HNB) as the result judgment standard, and then carry out the LAMP amplification reaction. After the reaction, If the color changes, it is judged as positive if the color development result is blue, which means that the pathogen of hickory dry rot has been detected; if the color does not change, the color development result is still blue and purple, and it is judged as negative, that is, it shows that there is no dried hickory in the sample Rot pathogen, or the content of hickory dry rot pathogen does not reach the detection limit;

[0068] Method 2: Take 5 μL of t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a loop-mediated isothermal amplification (LAMP) method for detecting pathogenic bacteria of canker disease of carya cathayensis. An LAMP primer composition is composed of four primers. The invention further discloses an LAMP kit used for detecting pathogenic bacteria of canker disease of carya cathayensis. The kit comprises the previous LAMP primer composition and further comprises 10*ThermoPol Buffer, dNTPs, MgCl2, glycine betaine, hydroxynaphthol blue, 8 U / muL Bst DNA polymerase and ddH2O. According to the method disclosed by the invention, the LAMP primers are designed according to a conserved region fragment sequence of beta-tubulin genes, the fast molecular detection technology system and reaction conditions are optimized, the pathogenic bacteria of the canker disease of carya cathayensis can be subjected to LAMP detection, the method is simple and convenient in reaction process, short in detection period, high in specificity and high in sensitivity, and the detection results can be observed by naked eyes.

Description

technical field [0001] The invention belongs to the field of biotechnology, relates to a loop-mediated isothermal amplification primer set and a method for using a loop-mediated isothermal amplification (LAMP) technology for detecting hickory dry rot pathogens, and belongs to early warning for detection, identification and prevention of plant diseases technology field. Background technique [0002] Hickory dry rot has generally occurred in hickory producing areas such as Lin'an, Chun'an, and Tonglu since 2002, and the affected area has gradually expanded. At present, the area of ​​occurrence has reached 270,000 mu. Severe cases of whole plant withering have occurred, and mild cases have affected growth and caused fruit drop According to calculations, the average output in the occurrence area has decreased by about 24%, which has become a bottleneck for the development of the pecan industry. There are different research reports or speculate that different factors are related...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11C12R1/645
CPCC12Q1/6844C12Q1/6895C12Q2531/119C12Q2563/173C12Q2527/101
Inventor 张传清童琪张佳星戴德江
Owner ZHEJIANG FORESTRY UNIVERSITY
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More