Loop-mediated isothermal amplification (LAMP) method for detecting pathogenic bacteria of canker disease of carya cathayensis
A hickory dry rot, ring-mediated isothermal technology, applied in the direction of microbial-based methods, biochemical equipment and methods, microbial measurement/inspection, etc., can solve the health hazards of experimenters, difficult access to primers, bromination Ethidium has huge toxicity and other problems, so as to increase the application value, get rid of the dependence on thermal cycle instruments, and achieve the effect of high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] Embodiment 1. A ring-mediated isothermal amplification kit for detecting pecan dry rot pathogens, including loop-mediated isothermal amplification primers for detecting pecan dry rot pathogens,
[0057] The LAMP primer composition consists of the following 4 primers:
[0058] Upstream outer primer (F3): 5'—CGCGTTCAGAAAGATTGCCATA—3';
[0059] Downstream outer primer (B3): 5'—TTGTTGCCAAAACACCCGC—3';
[0060] Upstream inner primer (FIP): 5'—GCGTGGGAGAACATCAATGAC-GCTCGAGCTGAAGGTCCG—3';
[0061] Downstream internal primer (FIB): 5'-CTTACACGCCAGAGCCGT-AACGCGAATCGACACCACAG-3'.
[0062] The kit contains: 10×ThermoPol Buffer, 1mM dNTPs, 4mM MgCl 2 , 0.6mM betaine, 150μM hydroxynaphthol blue (HNB), 8U / μL Bst DNA polymerase, ddH 2 O, 1.6 μM forward inner primer FIP, 1.6 μM reverse inner primer BIP, 0.2 μM forward outer primer F3, 0.2 μM reverse outer primer B3.
[0063] The 25 μL reaction system used in the experiment was prepared from the following ingredients: 8U / μL Bst DNA...
Embodiment 2
[0065] Embodiment 2, a kind of ring-mediated isothermal amplification method that is used to detect hickory dry rot pathogen:
[0066] Use the 25 μL detection reaction system to carry out the LAMP amplification reaction, and choose any of the following methods:
[0067] Method 1. Add the dye hydroxynaphthol blue (HNB) as a reaction indicator before the amplification, and use the color change of hydroxynaphthol blue (HNB) as the result judgment standard, and then carry out the LAMP amplification reaction. After the reaction, If the color changes, it is judged as positive if the color development result is blue, which means that the pathogen of hickory dry rot has been detected; if the color does not change, the color development result is still blue and purple, and it is judged as negative, that is, it shows that there is no dried hickory in the sample Rot pathogen, or the content of hickory dry rot pathogen does not reach the detection limit;
[0068] Method 2: Take 5 μL of t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


