Supercharge Your Innovation With Domain-Expert AI Agents!

Peeled catfish β-defensin gene and its β-defensin antimicrobial peptide and their application

A technology of β-defensins and antimicrobial peptides, which is applied in the field of molecular biology, can solve the problems of in-depth research, lack, and the influence of recombinant protein antibacterial experiments, and achieve the effect of simple operation

Active Publication Date: 2021-06-01
HUAZHONG AGRI UNIV
View PDF18 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The research on other few fish β-defensins is not in-depth, and the lack of sufficient and reliable recombinant protein antibacterial experiments and antibacterial effect statistics is currently affecting the evaluation of fish β-defensins antibacterial effect and its application in fish disease control. The problem with practice
Due to the differences in the β-defensin sequences of different fishes, the antibacterial effects of their recombinant proteins must be different

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Peeled catfish β-defensin gene and its β-defensin antimicrobial peptide and their application
  • Peeled catfish β-defensin gene and its β-defensin antimicrobial peptide and their application
  • Peeled catfish β-defensin gene and its β-defensin antimicrobial peptide and their application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1 Cloning of the open reading frame (ORF) fragment of the β-defensin gene of yellow catfish.

[0052] 1. Cloning of the open reading frame (ORF) fragment of the β-defensin gene of yellow catfish

[0053] According to the partial transcriptome data of the yellow catfish in our laboratory, the predicted sequence of the yellow catfish β-defensin gene was retrieved, and Primer 5.0 was used to design the primer Pf_ΒD-F1 / R1 for amplifying the ORF region of the β-defensin:

[0054] Pf_ΒD-F1: ATGAAGTATCAAGGGATGACCAT

[0055] Pf_ΒD-R1: TCAGAGAATAACGTGAGACACAC

[0056] The PCR reaction system is as shown in Table 1-1:

[0057] Table 1-1 PCR reaction system

[0058]

[0059] PCR reaction conditions: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 30 s, a total of 35 cycles; extension at 72°C for 10 min; 16°C for 5 min. After the reaction, 20 μL of the PCR product was added to 4 μL of 6×loading buff...

Embodiment 2

[0089] Example 2 The cloning of the core coding region of the yellow catfish β-defensin gene (with the signal peptide removed from the ORF) and the construction of the prokaryotic recombinant expression plasmid.

[0090] According to the characteristics of the restriction site on the prokaryotic expression plasmid PET-32a, a pair of specific primers Pf_BD-F2 / R2 with BamHI and EcoR I restriction sites were specially designed:

[0091] Pf_ΒD-F2: CGC GGATCC GCTAAAGGAAATGCAATGGC

[0092] Pf_ΒD-R2: CCG GAATTC TCAGAGAATAACGTGAGACACAC

[0093]The underlined parts of the primer sequences are the restriction sites of BamH I and EcoR I, respectively, and the bold parts (CGC and CCG) at the 5' end of the restriction sites are protective bases. Using PCR amplification technology, the ORF fragment cloned in Experiment 1 was used as the cDNA template, and the reaction program was (first, pre-denaturation at 95°C for 5 minutes; then, denaturation at 95°C for 30 seconds, annealing at 62°C...

Embodiment 3

[0094] Example 3: Induction and expression of prokaryotic recombinant expression vectors in Escherichia coli.

[0095] The constructed recombinant expression vector PET-32a-Pf_BD was introduced into Escherichia coli BL21 (DE3) competent cells, and the positive clones were picked on the plate and inoculated in 10 mL of LB liquid medium containing ampicillin, cultivated overnight at 37 ° C, 200 rpm, and added An equal volume of 30% glycerol was stored at -35°C for later use.

[0096] Exploration of the best induction expression conditions:

[0097] (1) Induction of expression at different times: Take 1 mL of spare bacteria and add it to 9 mL of LB liquid medium, cultivate to OD 600 0.6 to 0.8, then take 1mL of the bacterial solution and divide it into 2mL preparation tubes, a total of 7 tubes, at the same time take 1mL of the PET-32a empty plasmid bacterial solution under the same conditions as a control, and add 8 tubes of bacterial solution with a final concentration of 1mM ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention discloses a yellow catfish β-defensin gene and its β-defensin antibacterial peptide and its application; the invention successfully expresses the yellow catfish β-defensin recombinant protein PET‑32a‑Pf_BD using in vitro recombinant expression technology, and inhibits Bacterial activity identification results show that it has a certain antibacterial effect on Staphylococcus aureus in Gram-positive bacteria, Escherichia coli in Gram-negative bacteria, Aeromonas hydrophila, Edwardsiella and Flavobacterium columnar. effect. This laid the foundation for the application of defensin recombinant protein as a broad-spectrum antibacterial drug in aquaculture.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a yellow catfish β-defensin gene, a β-defensin antibacterial peptide and applications thereof. Background technique [0002] Yellow catfish is an important small and medium-sized freshwater economic fish in my country. It is favored by consumers because of its absence of intermuscular spines, delicious meat and rich nutrition. In recent years, it has become an important famous and high-quality farmed fish in my country's aquaculture industry. In 2015, the total output of yellow catfish in my country reached 355,725 tons, ranking the thirteenth among all freshwater fish output in my country. With the continuous increase of market demand, the current farming scale of yellow catfish is expanding year by year. However, large-scale and high-density farming will inevitably lead to the deterioration of the breeding water environment, and various bacterial diseases frequently o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12C07K14/46C12N15/70C12N1/21C12P21/02C07K1/34A61K38/17A61P31/04
CPCA61K38/00C07K14/461C12N15/70
Inventor 魏开建陈俭勇张桂蓉姬伟杨瑞斌樊启学
Owner HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More