A kind of Thiobacillus ferrooxidans and its application
A technology of Thiobacillus ferrooxidans and microbial strains, applied in the directions of bacteria, chemical instruments and methods, biochemical equipment and methods, etc., can solve the problems of high energy consumption and high cost of removal methods, and achieve low desulfurization cost and selectivity. High, responsive effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Isolation and screening of Acidithiobacillus ferrooxidans ZJ-2;
[0039] 1. Firstly, take 10mL sludge sample, add it to 90mL liquid 9k medium, and culture at 30°C and 150r / min for 3-4d.
[0040] 2. Inoculate the medium enriched for 3-4 days into a new 100mL liquid 9k medium according to 10% inoculum size, and culture again at 30°C and 150r / min for 2-3 days, repeating this 3-5 times. During the process of enrichment and primary screening, the color of the liquid in the bottle will change from light green to reddish brown, and a yellow precipitate will appear at the bottom.
[0041] 3. Dilute and spread the enriched medium on solid 9k medium, culture in a 30°C incubator, after 4 days of cultivation, select dominant colonies, and culture in liquid 9k medium to verify whether they are the required strains.
[0042] Concretely, the above-mentioned liquid 9k culture medium comprises: A liquid: (NH 4 ) 2 SO 4 3.0g, KCl 0.1g, K 2 HPO 4 0.5g, Ca(NO 3 ) 2 0.01g, MgSO ...
Embodiment 2
[0045] Immobilization of Acidithiobacillus ferrooxidans ZJ-2 in a bioreactor;
[0046] Add liquid 9k culture medium, add Acidithiobacillus ferrooxidans ZJ-2 bacterial solution at the end of logarithmic growth according to the inoculum amount of 10%, and then carry out Acidithiobacillus ferrooxidans ZJ-2 under the conditions of controlling temperature 30°C, pH value 2.4, and ventilation rate 0.4L / min. 2 Culture of bacteria. Timely determination of Fe in the reactor during cultivation 2+ Concentration, when Fe 2+ When the conversion rate reaches above 95%, the aeration is stopped, and the reactor is left standing for 6-8 hours, so that the mature bacterial cells can be fully and effectively adsorbed on the surface of the carrier, and the cells are immobilized. Then replace the fresh medium and re-inoculate the bacterial solution, repeat the above steps. When changing the medium for the 5th time and thereafter, the bacterial solution was no longer inoculated, and the cells ads...
Embodiment 3
[0048] Biotrickling filter reactor (such as figure 2 Shown) to the removal effect of hydrogen sulfide in the mixed gas;
[0049] After the film was stabilized in the bioreactor, a certain height of reacted Fe-rich 3+ medium, and let the medium circulate between the bioreactor and the chemical reactor, to ensure that the temperature of the reactor is 30°C and pH2.4, and the gas to be treated is introduced into the chemical reactor, the concentration of hydrogen sulfide is 1200ppm, and the gas flow rate is 5L / min, measure the concentration of hydrogen sulfide at the inlet and outlet, and calculate the removal rate of hydrogen sulfide. like Figure 5 shown.
[0050] Table 1 16sRNA nucleotide sequence list of acidophilic Thiobacillus ferrooxidans ZJ-2
[0051] AGGAATCTGTCTTTTAGTGGGGGACAACCCAGGGAAACTTGGGCTAATACCGCATGAGCCCTGAGGGGGAAAGCGGGGGATCTTCGGACCTCGCGCTAAGGGAAGAGCCTACGTCTGATTAGCTAGTTGGTAGGGTAAAGGCCTACCAAGGCGACGATCAGTAGCTGGTCTGAGAGGACGACCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTAC...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More