Application Let-7C gene to preparation of drug for treating Alzheimer disease

A technology for Alzheimer's disease and let-7c, applied in the field of biomedicine, to reduce the production of Aβ and inhibit pathological changes

Active Publication Date: 2017-09-08
SHANDONG UNIV QILU HOSPITAL
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

After searching, there is currently no relevant report on the application of Let-7 gene in the treatment of Alzheimer's disease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application Let-7C gene to preparation of drug for treating Alzheimer disease
  • Application Let-7C gene to preparation of drug for treating Alzheimer disease
  • Application Let-7C gene to preparation of drug for treating Alzheimer disease

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Karyotype analysis of DS cell lines

[0040] After DS cells were treated with colchicine (5ug / ml) for 3 hours, the cells were collected and treated with 0.075% KCl for 30 minutes (to expand the cells), and then fixed with fixative (methanol:glacial acetic acid, 3:1), and then The fixed cells were dropped onto the glass slide, treated with 0.025% trypsin for 1 minute, and finally stained with Giemsa for 10 minutes, and the karyotype analysis was carried out under the microscope. The results showed that the karyotype of the DS cell line was 47XX, +21( 1478), see figure 1 .

Embodiment 2

[0041] Example 2 Using cDNA gene chip and semi-quantitative RT-PCR to measure the expression of miRNA in DS cell line

[0042] Total RNA was isolated from DS cells (UMB1478) and control cells (UMB115) using TRI-Reat reagent. According to the instructions, use Multiplex RT Human Pool4, V1for Taqman miRAN, and use the above RNA sample as a template to synthesize cDNA. Using the above cDNA as a template, the commercial TLDA Human miRNA Panel chip was used to detect the expression of different miRNAs. The results showed that the expressions of Let-7c, miR-99a, and mir-155 were up-regulated, see figure 2 a.

[0043]Using semi-quantitative RT-PCR technology, the content of pre-Let-7c (Let-7c precursor) and Let-7c in DS cells (1478) and control cells (115) were respectively determined. In addition, from DS cells and APPsw / PS1AE9 Total RNA was extracted from the brains of double mutant transgenic mice (AD mice), and the expression level of Let-7c gene was detected by semi-quantitat...

Embodiment 3

[0044] Example 3 Double-sandwich ELISA detection of Aβ expression in HEK cells and 20E2 cells

[0045] HEK cells and 20E2 cells were cultured by conventional methods. Cloning the gene sequence of miR-7C (Let-7c), has-miR-99a (C99) into the p-super expression vector, constructing the expression plasmid of miR-7C, miR-99a, wherein has-miR-99a nucleoside The acid sequence is as shown in SEQ ID NO:2, specifically:

[0046] CCAUUGGCAUAAACCCGUAGAUCCGAUCUUGUGGUGAAGUGGACCGCACAAGCUCGCUUCUAUGGGUCUGUGUGUCAGUGUG. The plasmid was transfected into the cells according to the instructions of Lipofectamine plus, specifically: the constructed miR-7C expression plasmid and APP were co-transfected into HEK293 cells, the miR-7C and miR-99a expression plasmids were co-transfected into HEK293 cells, and miR-7C expression plasmids were co-transfected into HEK293 cells. The -7C expression plasmid was transfected into 20E2 cells alone. After the plasmid was transfected into the cells and cultured for...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of biomedicines, in particular to application of a non-coding micro-molecule RNA Let-7C gene to the preparation of a drug for treating an Alzheimer disease. The invention verifies through cDNA gene chip and semi-quantitative RT-PCR technology analysis that Let-7C expression in a DS cell and an AD mouse brain is significantly improved compared with that in a more normal cell; a Let-7C gene is of great significance in clinical diagnosis and prognostic judgment of the Alzheimer disease. Moreover, the invention verifies that Let-7C promotes the activity of BACE2 through increasing the promoter sub-region activity of the BACE2, so that the C99 expression is reduced, the C83 / 80 expression is increased, and the generation of beta-amyloid precipitation is inhibited, so that the Let-7C can be used for preparing the drug for treating the Alzheimer disease.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to the application of a non-coding small molecule RNA Let-7c gene in the preparation of drugs for treating Alzheimer's disease. Background technique [0002] Alzheimer's disease (AD), also known as senile dementia, is a progressive neurodegenerative disease and the most common type of dementia. Dysfunction and other neuropsychiatric symptoms and behavioral disturbances. Alzheimer's disease has two characteristic pathological changes: β-amyloid protein (β-amyloid protein, Aβ) plaque formation and neurofibrillary tangles. Aβ is a normal metabolite of the body, which is derived from the hydrolysis of β-amyloid precursor protein (APP). Under normal circumstances, its production and degradation are in a dynamic balance. When some reasons lead to abnormal APP metabolism When the Aβ production increases and (or) the degradation decreases, it will cause a large amount of Aβ deposition. APP is ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K31/7105A61K48/00A61P25/28
CPCA61K31/7105
Inventor刘恒孙秀莲陈帅孙芊
OwnerSHANDONG UNIV QILU HOSPITAL