Recombinant gene engineering bacteria producing theophylline and caffeine, and construction method and application of same

A technology of genetically engineered bacteria and caffeine, applied in the field of genetic engineering, can solve the problems of environmental pollution, high cost, and low extraction rate, and achieve the effect of less separation and purification steps, low cost, and high yield

Active Publication Date: 2017-09-15
ANHUI AGRICULTURAL UNIVERSITY
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a new method for the production of caffeine and theophylline by substrate-free fermentation using E.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant gene engineering bacteria producing theophylline and caffeine, and construction method and application of same
  • Recombinant gene engineering bacteria producing theophylline and caffeine, and construction method and application of same
  • Recombinant gene engineering bacteria producing theophylline and caffeine, and construction method and application of same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 Construction of Recombinant Engineering Bacteria BL21 / pRSF-TCS1-GUD1

[0031] 1. Cloning of the target gene

[0032] The complete sequences of tea tree caffeine synthase gene TCS1 and yeast guanine deaminase gene GUD1 in this example are found in GenBank accession numbers AB031280 and NC_00136, respectively. A pair of specific primers were designed according to the ORF sequences of the two target genes, and TCS1 gene and GUD1 gene were obtained by PCR amplification using tea tree cDNA and yeast genomic DNA as templates. Primer sequences (5'-3') are as follows:

[0033] TCS1-F: TAAGAAGGAGATATA CATATG ATGGAGCTAGCTACTGCGGGG

[0034] TCS1-R: CCAATTGAGATCTGC CATATG CTATCCATCAATCTTGGAAAGCAC

[0035] GUD1-F: TCATCACCACAGCCA GGATCC ATGACAAAAAAGTGATTTATTATTTGATAAATT

[0036] GUD1-R: GCCGAGCTCGAATTC GGATCC CTAAATCTGGTAGACTTGCTGGCC

[0037] Among them, in order to insert the TCS1 gene and the GUD1 gene into the expression vector, NdeI restriction sites were ...

Embodiment 2

[0044] Example 2 Fermentative production of caffeine and theophylline by recombinant engineering bacteria

[0045] 1. Preliminary culture: Pick a single colony of recombinant engineered bacteria BL21 / pRSF-GUD1-TCS1 in 3 mL of liquid LB medium, shake and culture overnight at 37° C. and 200 rpm. At the same time, in order to exclude the interference of the starting strain BL21(DE3) and the expression plasmid pRSF-Duet-1, the starting strain and the strain transformed with the expression vector without any target gene were cultured respectively as the blank control group.

[0046] 2. Expansion culture: Transfer the above-mentioned overnight cultured seed liquid into fresh LB liquid medium with 2% inoculum amount for expansion culture, the filling volume is 40mL / 150mL, and continue to shake and cultivate at 37°C and 200rpm. -3h (to OD 600 is 0.6-0.8).

[0047] 3. Induction of protein expression: Add IPTG at a final concentration of 1 mM to the bacterial solution in step (2), res...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene engineering, and discloses a novel recombinant gene engineering bacteria producing theophylline and caffeine, and a construction method and an application of same. In the invention, a caffeine synthetic and metabolic route with xanthine as a methyl receptor is mainly employed, and a tea tree caffeine synthetase gene TCS1 and a yeast guanine deaminase gene GUD1 are co-introduced into Escherichia coli so as to construct a recombinant Escherichia coli engineering bacteria that can produce the theophylline and caffeine through fermentation in vitro. The engineering bacteria can produce the theophylline and caffeine at high yield at the same time without addition of any substrate, yields of the theophylline and the caffeine respectively reaching 4.17 mg / L and 20.3 mg / L. The products, in a fermentation liquid, are easy to separate and purify. The recombinant gene engineering bacteria has excellent industrial application prospect.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a recombinant genetically engineered bacterium producing theophylline and caffeine and its construction method and application. Background technique [0002] Methylxanthines belong to purine alkaloids and are methylated derivatives of xanthines. According to their methylation position and quantity, they can be divided into 1-methylxanthine, 3-methylxanthine, 7 -methylxanthine, 3,7-dimethylxanthine (theobromine), 1,3-dimethylxanthine (theophylline), 1,7-dimethylxanthine and 1,3,7- Trimethylxanthine (caffeine). In nature, there are about 13 orders and more than 100 kinds of plants that contain methylxanthines. Among them, caffeine is a natural alkaloid present in plants, and it is also the main component of purine base in tea, which has various physiological effects on the human body. Adequate intake of caffeine can help the human body properly raise bloo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/70C12N1/21C12P17/18C12R1/19
CPCC12N9/1007C12N9/78C12N15/70C12P17/182C12Y201/0116C12Y305/04003
Inventor张正竹李萌萌邓威威孙莹潘思安
OwnerANHUI AGRICULTURAL UNIVERSITY