Primers for detecting Pseudomonas aeruginosa through loop-mediated isothermal amplification technology, and kit

A Pseudomonas aeruginosa, ring-mediated isothermal technology, applied in recombinant DNA technology, biochemical equipment and methods, microbial determination/inspection, etc. High and other problems, to achieve the effect of good sensitivity

Inactive Publication Date: 2017-09-15
赵吉光
View PDF1 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional detection methods have cumbersome procedures, long cycles and low sensitivity
Immunological methods are difficult to prepare antibodies, cannot detect multiple components at the same time, require high skills for experimenters, and are prone to cross-contamination
Molecular biology methods have the advantages of high sensitivity, accuracy, and speed, but require special instruments and equipment, are easily polluted, and require high inspection personnel

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] The primers for the detection of Pseudomonas aeruginosa by the loop-mediated isothermal amplification technique are as follows:

[0025] Outer primer pair F3 and B3:

[0026] Upstream primer F3: GCTCGTACGGAGATACAGCC;

[0027] Downstream primer B3: TGTTCACCGTTTGTATTGGCG;

[0028] Inner primer pair FIB and BiP:

[0029] Upstream primer FIP:

[0030] GTCGAATCCCTTTAGGACGGAGACCCTTTTCGAACGCGGGGAATGGCC;

[0031] Downstream primer BIP:

[0032] AAGTTCACACTGTGGAGGAGCAACCCAATAGACCCGAGCCATGTTTCC

[0033] Using the above primers, the present invention also provides a Pseudomonas aeruginosa gene rapid diagnosis kit, which comprises BstDNA polymerase, reaction solution, sample pretreatment solution, color development solution and positive control solution.

[0034] Reaction solution: Each 1L reaction solution contains 1.6~2mmol dNTP, 20~25mmol Tris-HCl, 10~12.5mmol potassium chloride, 10~12.5mmol ammonium sulfate, 8~10mmol magnesium sulfate, 1~1.25ml TritonX-100, 0.8-1 mol of ...

Embodiment 2

[0038] Example 2 specificity verification

[0039] Collect 20 strains of Pseudomonas aeruginosa and 30 strains of non-Pseudomonas aeruginosa. After culturing these strains in nutrient broth (Vibrio parahaemolyticus in 3.5% sodium chloride nutrient broth) at 37°C for 24 hours, take 1 mL For the bacterial solution, the DNA of each bacterium was extracted according to the primers provided in Example 1 and the loop-mediated isothermal amplification technique in the prior art, and LAMP amplification and chromogenic reagent were added for observation respectively.

[0040] The results are as follows: the detection primers of the present invention have good specificity, only Pseudomonas aeruginosa strains are amplified positive, and other non-Pseudomonas aeruginosa strains are negative.

Embodiment 3

[0041] Embodiment 3 Sensitivity comparative verification

[0042] The experiment was carried out according to the detection method and detection primers disclosed in the prior art Chinese patent CN 102134601 A, and a sensitivity comparison experiment was carried out with the primers provided by the present invention.

[0043] Taking Pseudomonas aeruginosa ATCC 27853 as a reference strain, after culturing it in LB medium at 37°C for 24 hours, take 1mL of the bacterial solution, dilute it 10 times with sterile saline, and select 5 dilutions for plate count.

[0044] The number of bacteria counted on the plate is as follows:

[0045] 0.01cfu / mL, 0.05cfu / mL, 0.25cfu / mL, 1.25cfu / mL, 6.25cfu / mL.

[0046] Extract bacterial DNA according to the detection method disclosed in the prior art Chinese patent CN 102134601 A, perform LAMP amplification, add a chromogenic agent for color development, and verify the sensitivity.

[0047] After 5 repeated experiments, among which the detectio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a set of primers for detecting Pseudomonas aeruginosa by a loop-mediated isothermal amplification technique and a rapid diagnosis kit for Pseudomonas aeruginosa gene. Prior art Chinese patent CN 102134601 A discloses a loop-mediated isothermal amplification detection primer, detection method and detection kit for Pseudomonas aeruginosa. This invention designs and screens the ecfX gene of Pseudomonas aeruginosa A set of specific detection primers, a detection kit containing the detection primers and the detection of LAMP by using the detection kit. Compared with the prior art, the present invention designs a group of new primers based on the ecfX gene. Through the comparison experiment of two groups of primers, the primers of the present invention have better sensitivity and high sensitivity.

Description

technical field [0001] The invention relates to a set of primers and a kit for detecting Pseudomonas aeruginosa by loop-mediated isothermal amplification technology, belonging to the technical field of biological detection. Background technique [0002] Pseudomonas aeruginosa (P.Aeruginosa), formerly known as Pseudomonas aeruginosa, is a highly lethal, hemolytic, and drug-resistant Gram-negative bacillus, which belongs to Pseudomonas in the Pseudomonas family in classification There are more than 200 kinds of bacteria in this genus, which are widely distributed in nature and are one of the most common bacteria in soil. The most important growth condition of this bacterium is a humid environment, and other conditions are not very demanding. Textiles are highly hygroscopic and have all the factors for the growth of Pseudomonas aeruginosa, which can provide an ideal environment for its reproduction, including suitable pH, temperature and water nutrition, and can also provide t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
CPCC12Q1/689
Inventor 赵吉光
Owner 赵吉光
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap