SNP molecular marker for detecting heterogenous cfDNA, detecting method and application
A molecular marker, heterologous technology, applied in DNA/RNA fragments, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problem of lack of detection, inability to provide individualized medication guidance for organ transplant patients, and inability to specifically extract cfDNA signals and other problems, to achieve the effect of wide detection range, high detection accuracy and high gene polymorphism
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0064] Example 1 SNP site screening
[0065] Select the dbSNP (data base SNP, https: / / www.ncbi.nlm.nih.gov / snp / ) database and the Chinese population database (stored in Suzhou Renren Gene Technology Co., Ltd.), the Chinese population database is based on 3000 cases of Chinese The catalog of genetic polymorphism sites constructed from the whole genome sample information, such as figure 1 As shown, there are some differential frequency information between the Chinese population database and the Hapmap database (http: / / www.hapmap.org), which represent the differential genetic loci in the Chinese population, enabling the Chinese population database to more accurately present the Chinese population genetic polymorphism information.
[0066] Sites with a minor allele frequency (MAF) close to 0.5 were screened from the above two databases, and 5754 target SNP sites shown in Table 1 were obtained.
[0067] The SNP sites of the drug metabolism genes, such as CYP3A4, CYP3A5 and CYP2D6...
Embodiment 2
[0094] Example 2 probe design and chip synthesis
[0095] 1. Probe Design
[0096]According to the coordinate position of the SNP site shown in Table 1 and Table 2 on the genome, the SNP site is used as the coordinate starting point, and the base sequence extending 80 bp bases to the 5' end is used as the sequence information to design the upstream probe. The needle does not include the SNP site sequence; with the SNP site as the coordinate starting point, the base sequence extending 80 bp bases to the 3' end is used as the sequence information to design the downstream probe, the downstream probe does not include the SNP site sequence; the rs1036431 position As an example, intercept the 80 bp sequences upstream and downstream of the SNP to obtain the upstream probe (GGCTTTTGAGCGCAGTTAACTTTTGGGCTGAAGGAAAATGGACATGCAAGCAGGAGGGAGAATCCTAGTTAGACTCCTCG) and the downstream probe (TTTTCACAAGTCATTGTCGATGTCACTGTCAGTGTAGTGGCCTTCAAGCTATAGGGAGCCACTCCTAATGAGCAACATG) respectively. The bidire...
Embodiment 3
[0099] Example 3 Preparation of Unimolecular Labeling Adapter
[0100] Single-molecule marker adapters (synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.) include adapters and specific molecular tags, wherein the adapters include 5'-adapters in the forward sequence and 3'-adapters in the reverse sequence; such as figure 2 and image 3 As shown, the 5'-linker is selected from the 5'-linker-1 shown in SEQ ID NO.1 or the 5'-linker-2 shown in SEQ ID NO.2, and the 3'-linker sequence is selected from SEQ ID 3'-linker-1 shown in NO.3 or 3'-linker-2 shown in SEQ ID NO.4; 5'-linker-2 is a partial sequence of the 3' end of 5'-linker-1, 3 '-Linker-2 is a partial sequence of the 5' end of 3'-Linker-1; as figure 2 As shown, a Y-shaped single-molecule marker adapter-1 is composed of 5'-adapter-1, 3'-adapter-1 and specific molecular tags, such as image 3 As shown, 5'-linker-2, 3'-linker-2 and specific molecular tags constitute a Y-shaped unimolecular marker linker-2; specific m...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


