Cas9/RNA system and application thereof

A gene and protein technology, which is applied in DNA preparation, recombinant DNA technology, and the stable introduction of foreign DNA into chromosomes, etc., can solve the problems that there are no related reports on genetic modification, so as to accelerate the breeding process, strengthen oil synthesis, and accelerate breeding speed effect

Inactive Publication Date: 2017-10-31
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF2 Cites 32 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, there is no report on the genetic modification of algae st

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cas9/RNA system and application thereof
  • Cas9/RNA system and application thereof
  • Cas9/RNA system and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 2

[0064] Realization of targeted knockout of thioesterase g9763 in Nannochloropsis

[0065]The Cas9 / RNA system is the coding DNA of the screening marker, Cas9 protein gene and gRNA; wherein, the Cas9 protein gene is: the Cas9 protein gene of Streptococcus pyogenes that has been codon-optimized and can be completely encoded; the coding DNA of the gRNA is capable of forming a certain The stem-loop structure, and the 5' end of the RNA sequence combined with the Cas9 protein has the base sequence of TCGAACGGAAAGTGTGTGGG; the screening marker is the hygromycin resistance gene.

[0066] (2) Construction of the carrier cassette

[0067] The constructed vector was amplified using PCR primers F:5-AAGGCGATTAAGTTGGGTA-3 and R:5-TGGCACGACAGGTTTCC-3 to obtain the PCR product of the linearized vector with Cas9 protein, hygromycin, and gRNA. The PCR product was routinely Perform Cycle Pure purification to make a Cassette for transformation.

[0068] (3) Electroporation method to introduce Ca...

Embodiment 3

[0079] Realization of targeted knockout of thioesterase g9763 in Nannochloropsis

[0080] The Cas9 / RNA system is the coding DNA of the screening marker, Cas9 protein gene and gRNA; wherein, the Cas9 protein gene is: the Cas9 protein gene of Streptococcus pyogenes that has been codon-optimized and can be completely encoded; the coding DNA of the gRNA is capable of forming a certain The stem-loop structure, and the 5' end of the RNA sequence combined with the Cas9 protein has the base sequence of AATTGGGATTTGAAGACGG; the screening marker is the hygromycin resistance gene.

[0081] The constructed vector was amplified using PCR primers F:5-AAGGCGATTAAGTTGGGTA-3 and R:5-TGGCACGACAGGTTTCC-3 to obtain the PCR product of the linearized vector with Cas9 protein, hygromycin, and gRNA. The PCR product was routinely Perform Cycle Pure purification to make a Cassette for transformation.

[0082] (3) Electroporation method to introduce Cassette into Nannochloropsis and select single clone...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to genetic engineering transformation of nannochloropsis oculata and particularly relates to a method for carrying out genetic transformation by using Cas9/CRISPR at a fixed point. A compound is formed by overexpressed Cas9 protein in the nannochloropsis oculata and gRNA, the Cas9 protein is used for carrying out site-specific cleavage on a genome double-stranded DNA under the guidance of the gRNA to cause gene mutation, and mutation is effectively screened by combining a sequencing technique. Fixed-point genetic engineering transformation is carried out on the nannochloropsis oculata by using a CRISPR/Cas technology, so that the algae species improvement efficiency of the nannochloropsis oculata can be significantly improved.

Description

technical field [0001] The invention relates to the technical field of biological genetic engineering, in particular to a Cas9 / RNA system and its application. Background technique [0002] Due to the non-renewability of fossil fuels, and the release of CO from burning fossil fuels 2 Due to the impact of the greenhouse effect, the development of reliable, environmentally friendly, and economically viable alternative energy sources has become an important task for our country and the world. Biofuels are an attractive alternative to existing gasoline. Today's renewable liquid fuels are mainly produced from food. Current biofuels include biodiesel from oily crops (e.g. soybeans, palm trees, tallow, gutter oil), bioethanol and other alcohols from sugar cane and cereals, H 2 , long chain hydrocarbons and biogas (Scott et al., 2010). The production of crop-based biofuels requires large amounts of arable land, which competes with edible crops for land, leading to a "food vs fuel...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/90C12N9/22C12R1/89
CPCC12N9/22C12N15/102C12N15/902C12N2810/10
Inventor 徐健王勤涛路延笃辛一魏力
Owner QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap