Cas9/RNA system and application thereof
A gene and protein technology, which is applied in DNA preparation, recombinant DNA technology, and the stable introduction of foreign DNA into chromosomes, etc., can solve the problems that there are no related reports on genetic modification, so as to accelerate the breeding process, strengthen oil synthesis, and accelerate breeding speed effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 2
[0064] Realization of targeted knockout of thioesterase g9763 in Nannochloropsis
[0065]The Cas9 / RNA system is the coding DNA of the screening marker, Cas9 protein gene and gRNA; wherein, the Cas9 protein gene is: the Cas9 protein gene of Streptococcus pyogenes that has been codon-optimized and can be completely encoded; the coding DNA of the gRNA is capable of forming a certain The stem-loop structure, and the 5' end of the RNA sequence combined with the Cas9 protein has the base sequence of TCGAACGGAAAGTGTGTGGG; the screening marker is the hygromycin resistance gene.
[0066] (2) Construction of the carrier cassette
[0067] The constructed vector was amplified using PCR primers F:5-AAGGCGATTAAGTTGGGTA-3 and R:5-TGGCACGACAGGTTTCC-3 to obtain the PCR product of the linearized vector with Cas9 protein, hygromycin, and gRNA. The PCR product was routinely Perform Cycle Pure purification to make a Cassette for transformation.
[0068] (3) Electroporation method to introduce Ca...
Embodiment 3
[0079] Realization of targeted knockout of thioesterase g9763 in Nannochloropsis
[0080] The Cas9 / RNA system is the coding DNA of the screening marker, Cas9 protein gene and gRNA; wherein, the Cas9 protein gene is: the Cas9 protein gene of Streptococcus pyogenes that has been codon-optimized and can be completely encoded; the coding DNA of the gRNA is capable of forming a certain The stem-loop structure, and the 5' end of the RNA sequence combined with the Cas9 protein has the base sequence of AATTGGGATTTGAAGACGG; the screening marker is the hygromycin resistance gene.
[0081] The constructed vector was amplified using PCR primers F:5-AAGGCGATTAAGTTGGGTA-3 and R:5-TGGCACGACAGGTTTCC-3 to obtain the PCR product of the linearized vector with Cas9 protein, hygromycin, and gRNA. The PCR product was routinely Perform Cycle Pure purification to make a Cassette for transformation.
[0082] (3) Electroporation method to introduce Cassette into Nannochloropsis and select single clone...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com