Cas9/RNA system and application thereof
A gene and protein technology, which is applied in DNA preparation, recombinant DNA technology, and the stable introduction of foreign DNA into chromosomes, etc., can solve the problems that there are no related reports on genetic modification, so as to accelerate the breeding process, strengthen oil synthesis, and accelerate breeding speed effect
Patent Information
- Authority / Receiving Office
- CN · China
- Current Assignee / Owner
- Publication Date
- 2017-10-31
- Estimated Expiration
- Not applicable · inactive patent
Smart Images

Figure 1 
Figure 2 
Figure 3
Abstract
Description
technical field
[0001] The invention relates to the technical field of biological genetic engineering, in particular to a Cas9 / RNA system and its application. Background technique
[0002] Due to the non-renewability of fossil fuels, and the release of CO from burning fossil fuels 2 Due to the impact of the greenhouse effect, the development of reliable, environmentally friendly, and economically viable alternative energy sources has become an important task for our country and the world. Biofuels are an attractive alternative to existing gasoline. Today's renewable liquid fuels are mainly produced from food. Current biofuels include biodiesel from oily crops (e.g. soybeans, palm trees, tallow, gutter oil), bioethanol and other alcohols from sugar cane and cereals, H 2 , long chain hydrocarbons and biogas (Scott et al., 2010). The production of crop-based biofuels requires large amounts of arable land, which competes with edible crops for land, leading to a "food vs fuel...
Examples
Embodiment 2
[0064] Realization of targeted knockout of thioesterase g9763 in Nannochloropsis
[0065]The Cas9 / RNA system is the coding DNA of the screening marker, Cas9 protein gene and gRNA; wherein, the Cas9 protein gene is: the Cas9 protein gene of Streptococcus pyogenes that has been codon-optimized and can be completely encoded; the coding DNA of the gRNA is capable of forming a certain The stem-loop structure, and the 5' end of the RNA sequence combined with the Cas9 protein has the base sequence of TCGAACGGAAAGTGTGTGGG; the screening marker is the hygromycin resistance gene.
[0066] (2) Construction of the carrier cassette
[0067] The constructed vector was amplified using PCR primers F:5-AAGGCGATTAAGTTGGGTA-3 and R:5-TGGCACGACAGGTTTCC-3 to obtain the PCR product of the linearized vector with Cas9 protein, hygromycin, and gRNA. The PCR product was routinely Perform Cycle Pure purification to make a Cassette for transformation.
[0068] (3) Electroporation method to introduce Ca...
Embodiment 3
[0079] Realization of targeted knockout of thioesterase g9763 in Nannochloropsis
[0080] The Cas9 / RNA system is the coding DNA of the screening marker, Cas9 protein gene and gRNA; wherein, the Cas9 protein gene is: the Cas9 protein gene of Streptococcus pyogenes that has been codon-optimized and can be completely encoded; the coding DNA of the gRNA is capable of forming a certain The stem-loop structure, and the 5' end of the RNA sequence combined with the Cas9 protein has the base sequence of AATTGGGATTTGAAGACGG; the screening marker is the hygromycin resistance gene.
[0081] The constructed vector was amplified using PCR primers F:5-AAGGCGATTAAGTTGGGTA-3 and R:5-TGGCACGACAGGTTTCC-3 to obtain the PCR product of the linearized vector with Cas9 protein, hygromycin, and gRNA. The PCR product was routinely Perform Cycle Pure purification to make a Cassette for transformation.
[0082] (3) Electroporation method to introduce Cassette into Nannochloropsis and select single clone...