Method for expression of nitrogenase gene in eukaryotic cells
A technology of eukaryotic cells and nitrogenase, applied in the field of genetic engineering, can solve the problems of low substrate reduction activity, few functions, narrow reaction substrate range, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] molybdenum ferroprotein structural gene NifH / NifE / NifB / NifN clone
[0056] Heliobacteriumchlorum genomic DNA was extracted according to the method of Ausubel et al. (1995).
[0057] (Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K (1995) Preparation of genomic DNA from bacteria. In: Current protocols in molecular biology. Wiley, New York)
[0058] Search for homologous sequence fragments of NifH / NifE / NifB / NifN in Heliobacteriumchlorum on the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ) of the NCBI website, and use Primer5 software to design primers. The primer sequences are listed in Table 1. The NifH / NifE / NifB / NifN gene sequence of 857 / 1388 / 831 / 1306bp was cloned, and the sequencing results showed that it was 100% homologous to the sequence published on the NCBI website.
[0059] PCR reaction system: 50ul
[0060] 10 pmol upstream primer,
[0061] 10 pmol downstream primer,
[0062] 2 ul template DNA,
...
Embodiment 2
[0075] Construction of NifH / NifE / NifB / NifN virus transformation vector and transfection
[0076] NifH / NifE / NifB / NifN The genes were connected into the vector Potato X pot virus (PVX) expression vector PVX-HisG-MF1 through ClaI / SalI, EagI / SalI, EagI / SalI, and ClaI / SalI restriction sites, respectively. The PVX-HisG-MF1-NifH / NifE / NifB / NifN vector has been verified by sequencing, and the gene has been successfully cloned into the expression vector. PVX-HisG-MF1-NifH / NifE / NifB / NifN was used in the transfection experiment of tobacco Nicotianabenthamiana after the in vitro transcription kit. After transfection, the tobacco was cultivated for 2-3 weeks under the conditions of 20-26 degrees, 12 hours of light and 12 hours of darkness, and the tobacco leaves with virus-infected spot symptoms were screened for protein SDS-PAGE and Western hybridization detection.
Embodiment 3
[0078] Transgenic tobacco SDS-PAGE detection and western blot analysis
[0079] The total protein of transgenic and non-transgenic tobacco leaves was extracted with a plant protein extraction kit. The obtained total protein of transgenic and non-transgenic tobacco leaves was detected by SDS-PAGE electrophoresis. Anti-his antibody (Invitrogen) antibody and horseradish peroxidase-conjugated secondary antibody (Invitrogen) were used for WESTERN hybridization detection. The results showed that NifH / NifE / NifB / NifN proteins were all successfully expressed in tobacco.
[0080] Other sequences involved in the present invention are as follows:
[0081] NifH sequence (SEQ ID No.9):
[0082]atgcgtcagatagccatttacggaaaaggtggtatcggtaaatctacgaccacccaaaacaccgtctccgccctcgccgagatgggtaaaaaaatcatgatcgtcggttgtgaccccaaagccgactctactcgtttgattcttcactccaaagcccaagcgacggttatggacctggcccgtgaaaaaggtactgtggaagacctcgaactggaagacgttctcctcaccggtttcgccgacatccgctgtgccgagtccggcggtcccgaacctggtgtaggctgtgccggccgc...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



