Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit for detecting human ESR1 gene mutation

A kit and human technology, applied in the field of molecular biology, can solve problems such as insufficient sensitivity, cumbersome operation, and increased detection cost

Active Publication Date: 2017-11-17
北京旌准医疗科技有限公司
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, Sanger sequencing technology is low in cost and is the gold standard for mutation detection. However, the sensitivity of this method is insufficient, and it can only detect more than 10% of mutations, which cannot meet the detection of trace free nucleic acid mutations in plasma.
The next-generation sequencing technology has high sensitivity, but it relies on expensive instruments and analysis software, the detection cycle is long, and the cost is greatly increased, making it difficult to be widely used in clinical testing
At present, the ARMS-PCR method is more commonly used, that is, the amplification refractory mutation system (ARMS) was established in 1989. This method has high sensitivity and good specificity, but too many detection sites lead to an increase in detection cost and operation cumbersome, and ARMS-PCR can only be used to detect known mutant genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting human ESR1 gene mutation
  • Kit for detecting human ESR1 gene mutation
  • Kit for detecting human ESR1 gene mutation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0097] Embodiment 1, design and synthesis of closed sequence and primer

[0098] 1. Design and synthesis of the closed sequence and primers of the first segment of ESR1 gene

[0099] The wild-type sequence of the first segment of the ESR1 gene is shown as sequence 1 in the sequence listing.

[0100] 5'-GCATTAATTTCACCAGTAATGAGTCTTTTTCATTTGAGTCAGCAGGGTTTTTCTTGCTTGTTTTCAGGCTTTGTGGATT TGACCCTCCATGATCAGGTCCACCTTCTAGAATGTGCCTGGCTAGAGATCCTGATGATTGGTCT CGTCTGGCGCTCCATGGAGCACCCAGGGAAGCTACTGTTT GCTCCTAACTTGCTCTTGGACAGGTAAGTGACCTGGCTGTAGCTTAGGAGTAGCATGTTCTTTACGATCATAGTTCATTCATG-3' (SEQ ID NO: 1 in the Sequence Listing)

[0101] According to the mutation position, the closed sequence (single-stranded DNA molecule) of the first segment of ESR1 gene was designed and synthesized. The closed sequence of the first segment of the ESR1 gene is shown as sequence 2 in the sequence listing (bases with asterisks in italics indicate that the bases are modified by locked nucleic acid).

[0102] 5'...

Embodiment 2

[0125] Embodiment 2, the method for detecting human ESR1 gene mutation

[0126] Compared to natural oligonucleotide sequences, locked nucleic acids have a stronger affinity for their reverse complementary DNA sequences. After repeated verification of the closed sequence of the first segment of the ESR1 gene, the closed sequence of the third segment of the ESR1 gene, and the number and position of locked nucleic acids in the closed sequence of the third segment of the ESR1 gene, the critical denaturation temperature Tc (lower than the closed sequence The Tm value between target DNA) is slightly higher than the Tm value of the PCR amplification product.

[0127] 1. Determine the product melting temperature (Tm)

[0128] Using the genomic DNA of normal human cells as a template, use primer pair A, primer pair B, and primer pair C to amplify on Light Cycler 480 fluorescent quantitative PCR instrument respectively. The reaction system is shown in Table 1. The reaction conditions a...

Embodiment 3

[0146] Embodiment 3, sensitivity experiment

[0147] The ESR1 gene of the human breast cancer MCF7 cell line was mutated, and 11 cell lines containing different constitutive mutations of the first segment of the ESR1 gene, the second segment of the ESR1 gene and the third segment of the ESR1 gene were obtained. The details of the 11 cell lines are shown in Table 5.

[0148] table 5

[0149]

[0150]

[0151] 1. Establish the culture method of the above-mentioned 11 cell lines, and extract the whole genome DNA of the 11 cell lines.

[0152] 2. Using the gradient dilution method, the whole genome DNA of 11 cell lines was mixed with the whole genome DNA of normal human cells according to a certain ratio (1:5, 1:10, 1:20, 1:100 or 1:200) , to obtain mixed DNA.

[0153] 3. Using mixed DNA as a template, use primer pair A or primer pair B or primer pair C to carry out biased amplification (see Table 6 for the PCR reaction system where the mutation region is the first segmen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention discloses a kit for detecting human ESR1 gene mutation. The kit comprises a component A and / or a component B and / or a component C, wherein the component A comprises a blocking sequence A and a primer pair A (comprising an upstream primer F1 and a downstream primer R1), the component B comprises a blocking sequence B and a primer pair B (comprising an upstream primer F2 and a downstream primer R2), the component C comprises a blocking sequence C and a primer pair C (comprising an upstream primer F3 and a downstream primer R3), and the nucleotide sequences of the blocking sequence A, the upstream primer F1, the downstream primer R1, the blocking sequence B, the upstream primer F2, the downstream primer R2, the blocking sequence C, the upstream primer F3 and the downstream primer R3 are respectively represented by the sequence 2, the sequence 3, the sequence 4, the sequence 6, the sequence 7, the sequence 8, the sequence 10, the sequence 11 and the sequence 12 in the sequence table. According to the present invention, the kit can detect the human ESR1 gene mutation, and has advantages of high accuracy, high sensitivity, and important application value.

Description

technical field [0001] The invention relates to the field of molecular biology, in particular to a kit for detecting human ESR1 gene mutation. Background technique [0002] Estrogen receptor (ERα) includes two categories: one is the classic nuclear receptor, including estrogen receptor α (estrogen receptor α, ERα) and estrogen receptor β (estrogen receptor β, ERβ), both located in In the nucleus, it mediates the genotype effect of estrogen, that is, it exerts the genotype regulation effect by regulating the transcription of specific target genes; the second is the membrane receptor, including the membrane component of the classic nuclear receptor and the G protein couple GPER1 (GPR30), Gaq-ER, and ER-X of the co-receptor family can mediate rapid non-genotypic effects and exert indirect transcriptional regulatory functions through second messenger systems. The role of ER is to provide a binding site for estrogen, which has an important impact on reproductive system developme...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6858C12Q1/6886C12Q2600/106C12Q2600/156C12Q2525/117C12Q2527/107C12Q2531/113C12Q2525/10C12Q1/68
Inventor 葛猛余倩王宏伟赵娜
Owner 北京旌准医疗科技有限公司