Kit for detecting human ESR1 gene mutation
A kit and human technology, applied in the field of molecular biology, can solve problems such as insufficient sensitivity, cumbersome operation, and increased detection cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0097] Embodiment 1, design and synthesis of closed sequence and primer
[0098] 1. Design and synthesis of the closed sequence and primers of the first segment of ESR1 gene
[0099] The wild-type sequence of the first segment of the ESR1 gene is shown as sequence 1 in the sequence listing.
[0100] 5'-GCATTAATTTCACCAGTAATGAGTCTTTTTCATTTGAGTCAGCAGGGTTTTTCTTGCTTGTTTTCAGGCTTTGTGGATT TGACCCTCCATGATCAGGTCCACCTTCTAGAATGTGCCTGGCTAGAGATCCTGATGATTGGTCT CGTCTGGCGCTCCATGGAGCACCCAGGGAAGCTACTGTTT GCTCCTAACTTGCTCTTGGACAGGTAAGTGACCTGGCTGTAGCTTAGGAGTAGCATGTTCTTTACGATCATAGTTCATTCATG-3' (SEQ ID NO: 1 in the Sequence Listing)
[0101] According to the mutation position, the closed sequence (single-stranded DNA molecule) of the first segment of ESR1 gene was designed and synthesized. The closed sequence of the first segment of the ESR1 gene is shown as sequence 2 in the sequence listing (bases with asterisks in italics indicate that the bases are modified by locked nucleic acid).
[0102] 5'...
Embodiment 2
[0125] Embodiment 2, the method for detecting human ESR1 gene mutation
[0126] Compared to natural oligonucleotide sequences, locked nucleic acids have a stronger affinity for their reverse complementary DNA sequences. After repeated verification of the closed sequence of the first segment of the ESR1 gene, the closed sequence of the third segment of the ESR1 gene, and the number and position of locked nucleic acids in the closed sequence of the third segment of the ESR1 gene, the critical denaturation temperature Tc (lower than the closed sequence The Tm value between target DNA) is slightly higher than the Tm value of the PCR amplification product.
[0127] 1. Determine the product melting temperature (Tm)
[0128] Using the genomic DNA of normal human cells as a template, use primer pair A, primer pair B, and primer pair C to amplify on Light Cycler 480 fluorescent quantitative PCR instrument respectively. The reaction system is shown in Table 1. The reaction conditions a...
Embodiment 3
[0146] Embodiment 3, sensitivity experiment
[0147] The ESR1 gene of the human breast cancer MCF7 cell line was mutated, and 11 cell lines containing different constitutive mutations of the first segment of the ESR1 gene, the second segment of the ESR1 gene and the third segment of the ESR1 gene were obtained. The details of the 11 cell lines are shown in Table 5.
[0148] table 5
[0149]
[0150]
[0151] 1. Establish the culture method of the above-mentioned 11 cell lines, and extract the whole genome DNA of the 11 cell lines.
[0152] 2. Using the gradient dilution method, the whole genome DNA of 11 cell lines was mixed with the whole genome DNA of normal human cells according to a certain ratio (1:5, 1:10, 1:20, 1:100 or 1:200) , to obtain mixed DNA.
[0153] 3. Using mixed DNA as a template, use primer pair A or primer pair B or primer pair C to carry out biased amplification (see Table 6 for the PCR reaction system where the mutation region is the first segmen...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


