Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Plant glutelin transferring and preserving related protein OsVHA-E1, as well as coding gene and application thereof

A gluten, gene technology, applied in the field of genetic engineering

Active Publication Date: 2017-12-08
NANJING AGRICULTURAL UNIVERSITY
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] VHA proteins play an important role in organisms, and there is no report on the involvement of VHA proteins in the sorting of rice storage proteins

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant glutelin transferring and preserving related protein OsVHA-E1, as well as coding gene and application thereof
  • Plant glutelin transferring and preserving related protein OsVHA-E1, as well as coding gene and application thereof
  • Plant glutelin transferring and preserving related protein OsVHA-E1, as well as coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Example 1. Discovery of glutenin transport and storage-related proteins and their encoding genes in plant seeds

[0047] 1. Distribution analysis and genetic analysis of mature glutenin content of rice mature glutenin-reducing mutant Y153

[0048] In the japonica rice variety Ningjing No. 1 mutant library, a strain with reduced mature glutenin content in seeds was screened by protein electrophoresis analysis, and its glutenin precursor was significantly increased compared with the normal type, named Y153 .

[0049] Compared with Ningjing 1, the main characteristics of Y153 are: the content of mature glutenin in seeds decreased (see figure 1 ), with massive accumulation of proglutenin and a seed opaque phenotype, see figure 2 .

[0050] The transmission electron microscope observation of the developing endosperm revealed that the type II protein body storing mature glutenin in Y153 was relatively Ningjing 1 ( image 3 A) The size is significantly smaller, and the sha...

Embodiment 2

[0086] Embodiment 2, the acquisition and identification of transgenic plants

[0087] 1. Construction of recombinant expression vector

[0088] The OsVHA-E1 gene was obtained by PCR amplification using the genomic DNA of Nipponbare (from the germplasm resource bank of the Rice Institute of Nanjing Agricultural University) as a template. The PCR primer sequences are as follows:

[0089] primer3:

[0090] 5'AATTCGAGCTCGGTACCCGGGGAAACTACTCTAAAAACCAACCAC 3' (SEQ ID NO. 6);

[0091]primer4:

[0092] 5'CGACTCTAGAGGATCCCCGGGTTTGCCCAACCAAGGACAACGAG 3' (SEQ ID NO. 7).

[0093] The above primers are located at 2.3 kb upstream and 1.1 kb downstream of the gene shown in SEQ ID NO.2, the amplified product contains the promoter part of the gene, and the PCR product is recovered and purified. The PCR product was cloned into the vector pCAMBIA1305 using the INFUSION recombination kit (Takara, Japan).

[0094] INFUSION recombination reaction system (10 μL): 1.0 μL of PCR product, 6.0 μL o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of gene engineering, and relates to a plant glutelin transferring and preserving related protein OsVHA-E1, as well as a coding gene and an application thereof. The protein is a protein as shown in (a) or (b), namely (a) protein consisting of amino acid sequences as shown in SEQ ID NO.1, and (b) protein which has an amino acid sequence as shown in SEQ ID NO.1, substituted and / or deleted and / or added with one or more amino acid residues, is related to plant glutelin transferring and preserving and is derived from SEQ ID NO.1. Transferring and preserving of a glutelin precursor in albumen can be influenced by the plant glutelin transferring and preserving related protein. Transgenetic plants with normal glutelin transferring and preserving can be cultured by guiding the coding gene of the protein into plants having abnormal glutelin transferring and preserving. The protein and coding gene thereof can be applied to plant genetic improvement.

Description

technical field [0001] The invention belongs to the field of genetic engineering and relates to a plant gluten protein transport and storage related protein OsVHA-E1, its coding gene and application. Background technique [0002] Rice is one of the most important food crops in the world. The successful application of hybrid rice has largely solved the food problem caused by the rapid increase in the world's population. However, with the continuous improvement of people's living standards, the cultivation of high-quality, high-nutrition and various functional rice is becoming an urgent problem. As the second largest nutrient in rice, rice seed storage protein determines the nutritional value of rice to a large extent. Therefore, the in-depth study of its synthetic transport pathway will help us improve rice through genetic engineering. [0003] Rice glutenin is first synthesized in the endoplasmic reticulum in the form of a 57kDa precursor, correctly folded with the assista...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/415C12N15/29C12N15/11C12N15/82A01H5/00
CPCC07K14/415C12N15/8251
Inventor 万建民王益华朱建平江玲田云录刘喜刘世家鲍依群
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com