Application of miR-24-1-5p to colorectal tumor
A colorectal tumor and sequence technology, applied in the field of biomedicine, can solve the problems of unclear function and slowdown of colorectal tumors, and achieve the effect of inhibiting proliferation and migration, strong specificity, and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0060] This example demonstrates that miR-24-1-5p is low-expressed in colorectal tumor tissues and cells, and its expression is up-regulated in tissues and CRC cell lines treated with BRB anthocyanins.
[0061] 1. Animal model construction:
[0062] Mice were divided into three groups, normal group mice (6), model group mice (10), black raspberry treatment group (10), five-week C57 mice of model group and black raspberry treatment group ( 18-20 g), after one week of adaptation, a single intraperitoneal injection of AOM (10 mg / kg body weight) was given to mice (6 weeks old). Starting 1 week after injection, animals received 2% DSS in drinking water for 1 week, then normal water for 2 more weeks (this cycle was repeated 2 times). During this period, the mice in the normal group and the model group were fed with normal feed, and the black raspberry treatment group was fed with feed containing 10% black raspberry, and the tumors in the intestines from the mice were detected to co...
Embodiment 2
[0081] Example 2 Application of miR-24-1-5p in the preparation of drugs for the treatment of colorectal tumors
[0082] 1. Preparation of miR-24-1-5p recombinant plasmid
[0083] 1.1) Genomic DNA was extracted from HCT-116 cells according to the Genomic DNA Extraction Kit;
[0084] 1.2) Query the miRBase database (http: / / www.mirbase.org / ) to obtain the hsa-miR-24-1-5p precursor sequence (CUCCGGUGCCUACUGAGCUGAUAUCAGUUCUCAUUUUUACACACUGGCUCAGUUCAGCAGGAACAGGAG), in which the hsa-miR-24-1-5p mature sequence (ugccuacugagcugauaucagu) ( 22 bp) Query its genome information through NCBI to obtain its flanking sequence, including 196 bp upstream of the 5' end of the mature sequence and 196 bp downstream of the 3' end. Primer5.0 software designed miR-24-1-5p primers, the 5' end of the upstream primer FORWARD introduced the Xhol I restriction site, and the 5' end of the downstream primer REVERSE introduced the internal restriction Bgl II restriction site, that is,
[0085] The FORWARD se...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap