Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of miR-24-1-5p to colorectal tumor

A colorectal tumor and sequence technology, applied in the field of biomedicine, can solve the problems of unclear function and slowdown of colorectal tumors, and achieve the effect of inhibiting proliferation and migration, strong specificity, and high sensitivity

Active Publication Date: 2017-12-08
LIAONING UNIVERSITY
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

MiR-24 slows down cholangiocarcinoma proliferation; tumor suppressor microRNA-24-1 inhibits tumor cell proliferation by targeting FOXM1 in bladder tumors; MicroRNA-24-3p promotes tumor cell proliferation in breast tumors by targeting p27Kipl; however, The function of miR-24-1-5p in colorectal tumors remains unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of miR-24-1-5p to colorectal tumor
  • Application of miR-24-1-5p to colorectal tumor
  • Application of miR-24-1-5p to colorectal tumor

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0060] This example demonstrates that miR-24-1-5p is low-expressed in colorectal tumor tissues and cells, and its expression is up-regulated in tissues and CRC cell lines treated with BRB anthocyanins.

[0061] 1. Animal model construction:

[0062] Mice were divided into three groups, normal group mice (6), model group mice (10), black raspberry treatment group (10), five-week C57 mice of model group and black raspberry treatment group ( 18-20 g), after one week of adaptation, a single intraperitoneal injection of AOM (10 mg / kg body weight) was given to mice (6 weeks old). Starting 1 week after injection, animals received 2% DSS in drinking water for 1 week, then normal water for 2 more weeks (this cycle was repeated 2 times). During this period, the mice in the normal group and the model group were fed with normal feed, and the black raspberry treatment group was fed with feed containing 10% black raspberry, and the tumors in the intestines from the mice were detected to co...

Embodiment 2

[0081] Example 2 Application of miR-24-1-5p in the preparation of drugs for the treatment of colorectal tumors

[0082] 1. Preparation of miR-24-1-5p recombinant plasmid

[0083] 1.1) Genomic DNA was extracted from HCT-116 cells according to the Genomic DNA Extraction Kit;

[0084] 1.2) Query the miRBase database (http: / / www.mirbase.org / ) to obtain the hsa-miR-24-1-5p precursor sequence (CUCCGGUGCCUACUGAGCUGAUAUCAGUUCUCAUUUUUACACACUGGCUCAGUUCAGCAGGAACAGGAG), in which the hsa-miR-24-1-5p mature sequence (ugccuacugagcugauaucagu) ( 22 bp) Query its genome information through NCBI to obtain its flanking sequence, including 196 bp upstream of the 5' end of the mature sequence and 196 bp downstream of the 3' end. Primer5.0 software designed miR-24-1-5p primers, the 5' end of the upstream primer FORWARD introduced the Xhol I restriction site, and the 5' end of the downstream primer REVERSE introduced the internal restriction Bgl II restriction site, that is,

[0085] The FORWARD se...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to application of miR-24-1-5p to colorectal tumor. An expression condition of the miR-24-1-5p in a colorectal tumor tissue and five types of colorectal tumor cell lines is detected by fluorescent quantitative PCR (Polymerase Chain Reaction) and a result finds out that the expression of the miR-24-1-5p in the colorectal tumor tissue and cells is obviously regulated downwards and the miR-24-1-5p plays an important regulation and control role in occurring and development processes of the colorectal tumor. By constructing an miR-24-1-5p overexpression carrier, a colorectal tumor cell Caco2 and HCT-116 cells are transfected, and MTT (Methyl Thiazolyl Tetrazolium), cell scratch, Transwell and plate cloning experiments are used for researching influences of the miR-24-1-5p on proliferation and migration of the colorectal tumor cells; results show that the miR-24-1-5p can be used for remarkably inhibiting the proliferation and the migration of the colorectal tumor cells and can be used for a biological preparation for treating the colorectal tumor.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and specifically relates to the application of miR-24-1-5p in colorectal tumors. Background technique [0002] MicroRNA (miRNA) is an endogenous small non-coding RNA with a length of 18-22nt, which interferes with the translation of mRNA by binding to the 3'-UTR of target mRNA, thereby regulating gene expression, and finally induces target mRNA or coding protein degradation. miRNAs play important roles in many biological processes, such as proliferation, differentiation, apoptosis, angiogenesis, and cell survival in various types of tumors, including colorectal tumors, breast tumors, bladder tumors, and non-small cell lung tumors. Many human neoplasms display aberrant expression of miRNAs that can act as tumor suppressors or oncogenes. In 1993, Lee et al. discovered the first miRNA, namely Lin-4, during the genetic analysis of nematodes. The discovery of microRNA may provide a new basis for...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/10C12N15/70A61K48/00A61K31/7088A61P35/00
CPCA61K31/7088C12Q1/6886C12Q2600/178
Inventor 毕秀丽张赫张立昊郭君李倩倩毛丽萍
Owner LIAONING UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com