A kind of protein for enhancing immune effect of pig vaccine and its application

An immune effect and protein technology, applied in the field of genetic engineering, can solve the problem of less application, and achieve the effects of simple preparation operation, good specificity and low cost

Active Publication Date: 2020-07-28
SICHUAN HUASHEN ANIMAL BIOLOGICAL PRODS
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, there are few applications of cytokines as immune adjuvants on the market

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of protein for enhancing immune effect of pig vaccine and its application
  • A kind of protein for enhancing immune effect of pig vaccine and its application
  • A kind of protein for enhancing immune effect of pig vaccine and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Obtaining nucleic acid molecules of proteins for enhancing the immune effect of porcine vaccines, the method is as follows:

[0040] Extraction of porcine total RNA: Extract porcine total RNA from tissues such as porcine spleen or lymph nodes according to the instructions of Promega’s RNA extraction kit.

[0041] Reverse transcription and PCR of IL-33 target gene: reverse transcription was carried out according to the RT-PCR kit of Promega Company, and the cDNA of IL-33-mRNA was obtained. Referring to the porcine IL-33 gene sequence (GeneBank number: AB292180), the following primers were designed:

[0042] IL-33-F120: cccatatgagtatcaaagaacattctgct

[0043] IL-33-R276: ccctcgagcattaagtttgagagcttaaatg

[0044] Using cDNA as a template, use the designed primers for PCR amplification:

[0045] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 minutes, 1 cycle; denaturation at 95°C for 30 seconds, annealing at 55°C for 30 seconds, extension at 72...

Embodiment 2

[0050] Construct Escherichia coli expression vector IL-33 / pET28a(+), the method is as follows:

[0051] (1) After the PCR amplification product obtained in Example 1 was double-digested with restriction endonucleases NcoI and XhoI, the digested product was recovered.

[0052] (2) Digest the vector pET28a(+) with restriction endonucleases NcoI and XhoI to recover the vector backbone.

[0053] (3) Ligate the digested product of step (1) with the vector backbone of step (2) with T4 DNA ligase to obtain a ligation product.

[0054] (4) Transform the ligation product of step (3) into Escherichia coli Rosetta (DE3) competent cells, pick out single clones for PCR identification, and carry out sequencing identification for positive clones. The sequencing results show that the recombinant plasmid IL-33 / pET28a was obtained .

[0055] Description of the structure of the recombinant plasmid IL-33 / pET28a: the DNA shown in sequence 2 of the sequence table is inserted between the NcoI and Xh...

Embodiment 3

[0057] Prepare recombinant cells containing the carrier IL-33 / pET28a(+), the method is as follows:

[0058] Escherichia coli Rosetta (DE3) containing pET28a-IL-33 was named Rosetta-IL-33 / pET28a to obtain recombinant cells.

[0059] The obtained recombinant cells Rosetta-IL-33 / pET28a and the vector Rosetta / pET28a obtained in Example 2 were respectively inoculated in LB medium containing 100 mg / mL kanamycin, and cultured with shaking at 37°C and 150 rpm until OD600=1 , and then add IPTG to a final concentration of 0.3mM, and induce at 37°C for 4h.

[0060] Centrifuge the pre- and post-induction bacterial solutions of Rosetta-IL-33 / pET28a and Rosetta / pET28a at 12,000rpm for 10min, collect the bacterial cells, resuspend them in PBS, and ultrasonically break the bacteria, centrifuge at 12,000rpm for 15min, and take the supernatant and precipitate separately Perform SDS-PAGE electrophoresis.

[0061] According to the results of SDS-PAGE electrophoresis, the detection result of Ros...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to a protein for enhancing an immune effect of a pig vaccine and application thereof, which relate to the field of genetic engineering. The protein for enhancing the immune effect of the pig vaccine has an amino acid sequence as shown below: (a) SEQ ID NO.1; or (b) a derived sequence obtained through replacing and / or deleting and / or adding one or more amino acid residues forthe amino acid sequence as shown in the SEQ ID NO.1 and having an immunocompetence promoting function as same as the SEQ ID NO.1. The protein is applied to combined immunization with a commercially available vaccine, can be beneficial to improving antigen immunocompetence and enhancing the immune effect of the vaccine, and is very suitable for preventing a pig virus disease.

Description

technical field [0001] The invention relates to the field of genetic engineering, and in particular to a protein for enhancing the immune effect of pig vaccines and its application. Background technique [0002] Various infectious diseases caused by pathogenic microorganisms such as viruses and bacteria infecting animals have seriously restricted the healthy development of the breeding industry in various countries and regions, and also have huge hidden dangers to human health. Therefore, the research on the prevention and control measures of animal infectious diseases has great economic value and social significance. Vaccine immunization is the main measure to prevent and control infectious diseases at present, but the conventional vaccines currently used are not ideal, with low immune efficiency and poor safety. two major problems. Therefore, enhancing the immune effect of vaccines under safe dose vaccination has become the focus of current vaccine development research. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K14/54C12N15/24C12N1/21C12N15/70A61K38/20A61K39/39A61P37/04C12R1/19
CPCA61K38/00A61K39/00C07K14/54C12N15/70
Inventor周远成蔡雨函牛婷代洪波李碧钟颖卓秀萍廖果林燕王雪涛
OwnerSICHUAN HUASHEN ANIMAL BIOLOGICAL PRODS