Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of reagent for detecting expression level of MLH1 to preparation of kit for detecting sensitivity of tumor targeted drug

A detection kit and tumor targeting technology, applied in the field of tumor molecular biology, can solve the problems of increased spontaneous mutation rate, genomic instability, decreased mismatch repair function, canceration, etc., and achieve the effect of good clinical application prospects.

Active Publication Date: 2018-05-15
WEST CHINA HOSPITAL SICHUAN UNIV
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is currently a lack of effective biomarkers to screen out subgroups that may be effective for targeted drugs such as sorafenib and sunitinib
At the same time, there are no effective hematological markers to monitor when such drugs become resistant, so that other therapeutic measures can be used in time to inhibit tumor progression
[0005] Mismatch repair protein 1 (MLH1) is a major gene of the DNA mismatch repair system. Studies have shown that MLH1 is closely related to the occurrence of tumors. The decrease or loss of its expression will cause the decrease of the mismatch repair function, so that the spontaneous mutation The rate of increase increases the instability of the genome, leading to abnormal proliferation of cells and cancer
However, there is no report on the relationship between MLH1 expression and the tumor-targeted drug Sorafenib or Sunitinib in the treatment of liver cancer and kidney cancer.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of reagent for detecting expression level of MLH1 to preparation of kit for detecting sensitivity of tumor targeted drug
  • Application of reagent for detecting expression level of MLH1 to preparation of kit for detecting sensitivity of tumor targeted drug
  • Application of reagent for detecting expression level of MLH1 to preparation of kit for detecting sensitivity of tumor targeted drug

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1 Relationship between MLH1 expression and tumor targeting drug sensitivity

[0036] 1. Establishment of tumor-targeted drug-resistant cell lines

[0037] Select 5 kinds of cell lines: kidney cancer cell line 786-0, ACHN; liver cancer cell line: HepG2, PLC / PRF / 5; human umbilical vein endothelial cell line: HUVEC, cultured in DMEM or 1640 medium respectively, and detect drugs by MTT method IC50 of sorafenib and sunitinib.

[0038] Then adopt the concentration gradient increasing continuous induction method (initially use the IC50 of each cell to treat the cells, change the liquid after the cells die to remove the floating dead cells, then gradually increase the drug concentration by 10%-20%, and induce drug-resistant cells after 3-6 months Complete) to induce sorafenib or sunitinib-resistant liver cancer cell lines, kidney cancer cell lines and human umbilical vein endothelial cell lines.

[0039] The specific results are shown in Tables 1 and 2 below:

[0040...

Embodiment 3

[0061] Example 3 Clinical detection of the expression level of MLH1 in patients with sensitive and drug-resistant tumors

[0062] Tumor pathological specimens of clinically sorafenib or sunitinib-resistant and sensitive renal clear cell carcinoma patients were collected (28 sorafenib-sensitive patients with a median age of 33 years; 30 sorafenib-resistant patients with a median age of 38 years; 35 sunitinib-sensitive patients, with a median age of 37 years; 29 sunitinib-resistant patients, with a median age of 42 years), using RT-PCR to detect sorafenib or sunitinib primary drug-resistant and drug-sensitive tumors in histopathological specimens mRNA levels of MLH1.

[0063] The MLH-1 detection primers used are as follows:

[0064] Forward primer: TATTCATAGGCAAGATGCTGGC;

[0065] Reverse primer: TATGGTTGTTCTCGTCTCCTTCTC.

[0066] The result is as figure 2 As shown, among them, the expression level of MLH1 in tumor pathological specimens of Sorafenib-sensitive patients was ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for detecting sensitivity of a tumor targeted drug. The kit comprises an optional reagent for detecting the expression level of MLH1. The invention also discloses application of the reagent to detection of the expression level of the MLH1 in preparation of the kit for detecting the sensitivity of the tumor targeted drug. The kit has the advantages that by detecting the expression level of the MLH1, the sensitivity of a tumor patient to the targeted drugs (sorafenib and sunitinib) can be judged, the drug treatment effect on the tumor patient can be predicted in theclinical application, the basis is provided for the patient to take the related treatment measure or decision, and the clinical application prospect is good.

Description

technical field [0001] The invention belongs to the field of tumor molecular biology, and in particular relates to the use of a reagent for detecting the expression level of MLH1 in the preparation of a tumor targeting drug sensitivity detection kit. Background technique [0002] With the development of molecular biology technology, people have a better understanding of the pathogenesis of tumors, and then began to target cell receptors, key genes and regulatory molecules, which is called "targeted therapy". Therefore, Tumor targeting drugs have also become an important drug for the treatment of tumors. Compared with traditional chemotherapy drugs, tumor-targeted drugs have the advantages of strong specificity, obvious curative effect, and less damage to normal tissues. There are two main types of such drugs, monoclonal antibodies and small molecule compounds. Now there are multi-target therapeutic drugs—sorafenib (launched in 2005, sorafenib, BAY43-9006), sunitinib (launch...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6886C12N15/11A61K45/00A61P35/00
CPCA61K45/00C12Q1/6886C12Q2600/106C12Q2600/158
Inventor 彭星辰何金兰李平
Owner WEST CHINA HOSPITAL SICHUAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More