Application of reagent for detecting expression level of MLH1 to preparation of kit for detecting sensitivity of tumor targeted drug
A detection kit and tumor targeting technology, applied in the field of tumor molecular biology, can solve the problems of increased spontaneous mutation rate, genomic instability, decreased mismatch repair function, canceration, etc., and achieve the effect of good clinical application prospects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1 Relationship between MLH1 expression and tumor targeting drug sensitivity
[0036] 1. Establishment of tumor-targeted drug-resistant cell lines
[0037] Select 5 kinds of cell lines: kidney cancer cell line 786-0, ACHN; liver cancer cell line: HepG2, PLC / PRF / 5; human umbilical vein endothelial cell line: HUVEC, cultured in DMEM or 1640 medium respectively, and detect drugs by MTT method IC50 of sorafenib and sunitinib.
[0038] Then adopt the concentration gradient increasing continuous induction method (initially use the IC50 of each cell to treat the cells, change the liquid after the cells die to remove the floating dead cells, then gradually increase the drug concentration by 10%-20%, and induce drug-resistant cells after 3-6 months Complete) to induce sorafenib or sunitinib-resistant liver cancer cell lines, kidney cancer cell lines and human umbilical vein endothelial cell lines.
[0039] The specific results are shown in Tables 1 and 2 below:
[0040...
Embodiment 3
[0061] Example 3 Clinical detection of the expression level of MLH1 in patients with sensitive and drug-resistant tumors
[0062] Tumor pathological specimens of clinically sorafenib or sunitinib-resistant and sensitive renal clear cell carcinoma patients were collected (28 sorafenib-sensitive patients with a median age of 33 years; 30 sorafenib-resistant patients with a median age of 38 years; 35 sunitinib-sensitive patients, with a median age of 37 years; 29 sunitinib-resistant patients, with a median age of 42 years), using RT-PCR to detect sorafenib or sunitinib primary drug-resistant and drug-sensitive tumors in histopathological specimens mRNA levels of MLH1.
[0063] The MLH-1 detection primers used are as follows:
[0064] Forward primer: TATTCATAGGCAAGATGCTGGC;
[0065] Reverse primer: TATGGTTGTTCTCGTCTCCTTCTC.
[0066] The result is as figure 2 As shown, among them, the expression level of MLH1 in tumor pathological specimens of Sorafenib-sensitive patients was ...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com