Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer and kit for identifying Brucella gene-deleted vaccine and naturally-infected strain based on RPA (recombinase polymerase amplification) method and application thereof

A gene deletion vaccine, Brucella technology, applied in the field of vaccines, can solve the problems of difficulty, pathogenicity, virulence and strong gene recombination, etc., and achieve the effect of simple and fast operation and accurate detection results

Inactive Publication Date: 2018-05-15
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the vaccines used for animal brucellosis immunity in my country include attenuated Brucella ovis vaccine M5-90, Brucella porcine S2 strain and Brucella abortus bovine S19 strain, but these vaccine strains cannot be distinguished from natural infection , which brings certain difficulties to the prevention and control work. The use of various vaccines not only interferes with vaccine immunity and the differential diagnosis of natural infection, but also the vaccine strains are pathogenic to humans to varying degrees, and there are virulence reversion, gene recombination, etc. risk factors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and kit for identifying Brucella gene-deleted vaccine and naturally-infected strain based on RPA (recombinase polymerase amplification) method and application thereof
  • Primer and kit for identifying Brucella gene-deleted vaccine and naturally-infected strain based on RPA (recombinase polymerase amplification) method and application thereof
  • Primer and kit for identifying Brucella gene-deleted vaccine and naturally-infected strain based on RPA (recombinase polymerase amplification) method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] According to the specific conserved region of Brucella sheep pb26 gene sequence, design pb26 gene common PCR primers and RPA primers and probes, the size of the target fragment is 340bp, all the primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. Wherein the probe sequence (SEQ ID No.3) has a fluorescent group FAM and a quencher group BHQ1, the two groups are separated by THF, and the 3' end is modified by phosphorylation. The designed primers are SEQ ID No.1 and SEQ ID No.2.

[0047] SEQ ID No.1: 5'-GGAAAAATTTTGGATGAATCCGTCACGCTCG-3';

[0048] SEQ ID No.2: 5'-TGCAGGCGTGGGGCTTGGCCGTGTGGTGGA-3';

[0049] SEQ ID No. 3: 5'-GGCGGTGATTTGAACCTGGTCAATGATAA(FAM-dt)C(THF)C(BHQ)CCGCCGTGATCAAC-P-3'.

[0050] SEQ ID No.4:5'-TGTAGGAGATTTTATGAACACTCGTGCTAGCAATTTTCTCGCAGCCTCATTTTCCACAATCATGCTCGTCGGCGCTTTCAGCCTGCCCGCTTTCGCACAGGAGAATCAGATGACGACGCAGCCCGCGCGCATCGCCGTCACCGGGGAAGGCATGATGACGGCCTCGCCCGATATGGCCATTCTCAATCTCTCGGTGCTACGCCAGGCAAAGACCGCGCGCGAAGCCATGACCGCGAATAATGA...

Embodiment 2

[0057] Chlamydia-specific fluorescent RPA detection using Exo kit

[0058] 4.1 Specific fluorescent RPA detection

[0059] With SEQ ID No.3 as probe, SEQ ID No.1 and SEQ ID No.2 as primers, with Brucella melis M5-90△26 vaccine strain (provided by Harbin Veterinary Research Institute of Chinese Academy of Agricultural Sciences and Chinese Academy of Agricultural Sciences Jointly constructed and researched by Lanzhou Veterinary Research Institute), Brucella ovis M5 wild strain, Chlamydia abortus, Toxoplasma gondii, and Campylobacter fetalis genomic DNA as detection targets, and the DNA of naturally infected strains of Brucella as positive control , using the combination of primers and probes provided by the present invention, performing amplification according to the instructions of the TwistAmp Basic kit kit, and using a fluorescent quantitative PCR instrument for signal detection.

[0060] The detailed operation steps are as follows: use TwistAmp Basic kit to prepare 50 μL RP...

Embodiment 3

[0066] Fluorescence RPA detection sensitivity analysis

[0067] 1. Construction of plasmid standards

[0068] (1) Acquisition of bp26 gene

[0069] The upstream and downstream primers of common PCR amplification primers are respectively named as SEQ ID No.5 and SEQ ID No.6, wherein SEQ ID No.5 and SEQ ID No.6 are shown below, and RPA primers are subject to further screening. FP: 5'-ATCCACCAGTCTCACGGTTC-3', namely SEQ ID No.5

[0070] RP: 5'-GGCGTCATACCCCAGCTAT-3', namely SEQ ID No.6

[0071] Using the PCR amplification primers SEQ ID No.5 and SEQ ID No.6 of the gene bp26, the genome of the Brucella M5 wild strain was amplified by PCR. The 50 μL PCR reaction system was as follows: upstream primer, 1 μL; downstream primer , 1 μL; ExTaq premixed enzyme, 25 μL; template (genome), 2 μL; deionized water, 21 μL. PCR amplification program: first fully denatured at 95°C for 5min; then 35 cycles, respectively: denaturation at 94°C for 30s; annealing at 56°C for 30s; extension at 72°...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer and a kit for identifying a Brucella gene-deleted vaccine and a naturally-infected strain based on a RPA (recombinase polymerase amplification) method, and belongs to the technical field of diagnosis. The primer for identifying the Brucella gene-deleted vaccine and the naturally-infected strain based on the RPA method is designed by using a deleted specific conserved domain with pb26 gene sequence in the naturally-infected strain and the vaccine as a template. The primer pair has stronger specificity when the pb26 gene of the Brucella is detected by the RPA method; the naturally-infected Brucella can be effectively detected by the RPA method, but the deleted vaccine strain cannot be detected out. The kit for identifying the Brucella gene-deleted vaccine andthe naturally-infected strain based on the RPA method has the advantages that the operation is simple, convenient and rapid, and the like; the clinical diagnosis function is realized; the detection result is accurate.

Description

technical field [0001] The invention belongs to the technical field of vaccines, and in particular relates to a primer and a kit for identifying Brucella gene deletion vaccines and natural infection strains based on the RPA method. Background technique [0002] Brucella is a Gram-negative facultative intracellular parasite that widely infects domestic animals, wild animals and humans. Brucella in livestock animals mainly infects sheep, cattle and pigs. Mainly Brucella malta and Brucella abortus; Brucellosis infection of livestock causes epididymitis in males and abortion, placental inflammation, and infertility in pregnant livestock; in humans, brucellosis can cause acute inflammation and many flu-like symptoms, including wave fever, sweating, back pain, and weakness. In some patients, acute clinical symptoms persist for more than a year, eventually leading to chronic persistent infection. Chronic clinical symptoms include irregular fever, arthralgia, and fatigue, concurre...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/6844C12Q1/04C12N15/11C12R1/01
CPCC12Q1/6844C12Q1/689C12Q2521/507C12Q2522/101C12Q2531/119
Inventor 周继章李兆才费媛媛娄忠子穆赛福·穆罕默德
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com