Primer and kit for identifying Brucella gene-deleted vaccine and naturally-infected strain based on RPA (recombinase polymerase amplification) method and application thereof
A gene deletion vaccine, Brucella technology, applied in the field of vaccines, can solve the problems of difficulty, pathogenicity, virulence and strong gene recombination, etc., and achieve the effect of simple and fast operation and accurate detection results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] According to the specific conserved region of Brucella sheep pb26 gene sequence, design pb26 gene common PCR primers and RPA primers and probes, the size of the target fragment is 340bp, all the primers were synthesized by Shanghai Sangon Bioengineering Co., Ltd. Wherein the probe sequence (SEQ ID No.3) has a fluorescent group FAM and a quencher group BHQ1, the two groups are separated by THF, and the 3' end is modified by phosphorylation. The designed primers are SEQ ID No.1 and SEQ ID No.2.
[0047] SEQ ID No.1: 5'-GGAAAAATTTTGGATGAATCCGTCACGCTCG-3';
[0048] SEQ ID No.2: 5'-TGCAGGCGTGGGGCTTGGCCGTGTGGTGGA-3';
[0049] SEQ ID No. 3: 5'-GGCGGTGATTTGAACCTGGTCAATGATAA(FAM-dt)C(THF)C(BHQ)CCGCCGTGATCAAC-P-3'.
[0050] SEQ ID No.4:5'-TGTAGGAGATTTTATGAACACTCGTGCTAGCAATTTTCTCGCAGCCTCATTTTCCACAATCATGCTCGTCGGCGCTTTCAGCCTGCCCGCTTTCGCACAGGAGAATCAGATGACGACGCAGCCCGCGCGCATCGCCGTCACCGGGGAAGGCATGATGACGGCCTCGCCCGATATGGCCATTCTCAATCTCTCGGTGCTACGCCAGGCAAAGACCGCGCGCGAAGCCATGACCGCGAATAATGA...
Embodiment 2
[0057] Chlamydia-specific fluorescent RPA detection using Exo kit
[0058] 4.1 Specific fluorescent RPA detection
[0059] With SEQ ID No.3 as probe, SEQ ID No.1 and SEQ ID No.2 as primers, with Brucella melis M5-90△26 vaccine strain (provided by Harbin Veterinary Research Institute of Chinese Academy of Agricultural Sciences and Chinese Academy of Agricultural Sciences Jointly constructed and researched by Lanzhou Veterinary Research Institute), Brucella ovis M5 wild strain, Chlamydia abortus, Toxoplasma gondii, and Campylobacter fetalis genomic DNA as detection targets, and the DNA of naturally infected strains of Brucella as positive control , using the combination of primers and probes provided by the present invention, performing amplification according to the instructions of the TwistAmp Basic kit kit, and using a fluorescent quantitative PCR instrument for signal detection.
[0060] The detailed operation steps are as follows: use TwistAmp Basic kit to prepare 50 μL RP...
Embodiment 3
[0066] Fluorescence RPA detection sensitivity analysis
[0067] 1. Construction of plasmid standards
[0068] (1) Acquisition of bp26 gene
[0069] The upstream and downstream primers of common PCR amplification primers are respectively named as SEQ ID No.5 and SEQ ID No.6, wherein SEQ ID No.5 and SEQ ID No.6 are shown below, and RPA primers are subject to further screening. FP: 5'-ATCCACCAGTCTCACGGTTC-3', namely SEQ ID No.5
[0070] RP: 5'-GGCGTCATACCCCAGCTAT-3', namely SEQ ID No.6
[0071] Using the PCR amplification primers SEQ ID No.5 and SEQ ID No.6 of the gene bp26, the genome of the Brucella M5 wild strain was amplified by PCR. The 50 μL PCR reaction system was as follows: upstream primer, 1 μL; downstream primer , 1 μL; ExTaq premixed enzyme, 25 μL; template (genome), 2 μL; deionized water, 21 μL. PCR amplification program: first fully denatured at 95°C for 5min; then 35 cycles, respectively: denaturation at 94°C for 30s; annealing at 56°C for 30s; extension at 72°...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com