Sour porridge-based probiotics with high antioxidant and cholesterol-lowering activities and their application
An active probiotics and cholesterol-lowering technology, applied in microorganism-based methods, applications, biochemical equipment and methods, etc., can solve the problems of unstable product taste and uncontrollable product quality, and achieve ABTS and DPPH clearance rate improvement, Maintain the balance of intestinal flora and increase the effect of intestinal beneficial bacteria
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Sample source: Fermented sour porridge samples were collected from families who have been making sour porridge all year round in Hetao, Inner Mongolia.
[0059] Mix the collected sour porridge samples, serially dilute the samples with sterile water, take 0.1mL sample and add 0.9mL sterile water (10-fold gradient dilution), take 0.1mL diluted sour porridge in MRS solid medium coating on. After 48 hours of culture, the colonies that produced transparent circles were picked from the separation plate for three-section line purification. After microscopic examination confirmed that they were pure species, a single colony was picked and cultured in MRS liquid medium for 48 hours. The bacterial solution was mixed with 60% glycerol at a volume ratio of 3:1 and stored at -80°C for later use.
[0060] The formula and conditions of MRS solid medium are: peptone 10g, beef extract 10g, yeast powder 5g, glucose 20g, anhydrous sodium acetate 5g, Tween-801mL, diamine citrate 2g, dipot...
Embodiment 2
[0062] Morphological identification of strains
[0063] The morphological characteristics of the strains were detected by Gram staining. The results are shown in Figure 1, the strains screened by the present invention belong to Gram-positive bacteria. Among the 23 isolated strains, there are three kinds of rod-shaped, short-rod-shaped and spherical strains, which are arranged in single, pair or short chain.
Embodiment 3
[0065] Molecular biological identification of strains
[0066] The isolated strains were cultured using MRS liquid based on static culture in a 37°C incubator for 12 hours, and DNA extraction from the bacterial liquid was carried out using the TIANGEN Bacterial Extraction Kit according to its instructions. Use the following primers 27f 5'AGAGTTTGATCCTGGCTCAG 3' and 1492r 5'GGTTACCTTGTTACGACTT 3' to carry out PCR amplification of the 16S rRNA gene sequence of this bacterium, and the amplification results are shown in figure 2 . The PCR reaction conditions were as follows: 95°C, 10min; 94°C, 1min; 55°C, 1min; 72°C, 2min, 30 cycles; 72°C, 10min. The length of the amplified fragment is about 1500bp. After the PCR amplification product was purified, it was submitted to Jinweizhi Company for analysis and determination. The sequencing results were compared by blast on Genbank, and the results showed that the lactic acid bacteria isolated from traditional sour porridge included La...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


