Sour porridge-based probiotics with high antioxidant and cholesterol-lowering activities and their application

An active probiotics and cholesterol-lowering technology, applied in microorganism-based methods, applications, biochemical equipment and methods, etc., can solve the problems of unstable product taste and uncontrollable product quality, and achieve ABTS and DPPH clearance rate improvement, Maintain the balance of intestinal flora and increase the effect of intestinal beneficial bacteria

Active Publication Date: 2021-11-02
TIANJIN UNIV OF SCI & TECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, there are a series of problems such as unstable product taste and uncontrollable product quality.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Sour porridge-based probiotics with high antioxidant and cholesterol-lowering activities and their application
  • Sour porridge-based probiotics with high antioxidant and cholesterol-lowering activities and their application
  • Sour porridge-based probiotics with high antioxidant and cholesterol-lowering activities and their application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Sample source: Fermented sour porridge samples were collected from families who have been making sour porridge all year round in Hetao, Inner Mongolia.

[0059] Mix the collected sour porridge samples, serially dilute the samples with sterile water, take 0.1mL sample and add 0.9mL sterile water (10-fold gradient dilution), take 0.1mL diluted sour porridge in MRS solid medium coating on. After 48 hours of culture, the colonies that produced transparent circles were picked from the separation plate for three-section line purification. After microscopic examination confirmed that they were pure species, a single colony was picked and cultured in MRS liquid medium for 48 hours. The bacterial solution was mixed with 60% glycerol at a volume ratio of 3:1 and stored at -80°C for later use.

[0060] The formula and conditions of MRS solid medium are: peptone 10g, beef extract 10g, yeast powder 5g, glucose 20g, anhydrous sodium acetate 5g, Tween-801mL, diamine citrate 2g, dipot...

Embodiment 2

[0062] Morphological identification of strains

[0063] The morphological characteristics of the strains were detected by Gram staining. The results are shown in Figure 1, the strains screened by the present invention belong to Gram-positive bacteria. Among the 23 isolated strains, there are three kinds of rod-shaped, short-rod-shaped and spherical strains, which are arranged in single, pair or short chain.

Embodiment 3

[0065] Molecular biological identification of strains

[0066] The isolated strains were cultured using MRS liquid based on static culture in a 37°C incubator for 12 hours, and DNA extraction from the bacterial liquid was carried out using the TIANGEN Bacterial Extraction Kit according to its instructions. Use the following primers 27f 5'AGAGTTTGATCCTGGCTCAG 3' and 1492r 5'GGTTACCTTGTTACGACTT 3' to carry out PCR amplification of the 16S rRNA gene sequence of this bacterium, and the amplification results are shown in figure 2 . The PCR reaction conditions were as follows: 95°C, 10min; 94°C, 1min; 55°C, 1min; 72°C, 2min, 30 cycles; 72°C, 10min. The length of the amplified fragment is about 1500bp. After the PCR amplification product was purified, it was submitted to Jinweizhi Company for analysis and determination. The sequencing results were compared by blast on Genbank, and the results showed that the lactic acid bacteria isolated from traditional sour porridge included La...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a probiotic with high anti-oxidation and cholesterol-lowering activity based on sour porridge and its application. The name of the strain is SZ8, and the preservation unit is: General Microbiology Center (CGMCC) of China Microbiological Culture Collection Management Committee, and the preservation number is CGMCC No. .13311. Experiments have proved that the strain has strong acid resistance and bile salt resistance. Afterwards, the dominant strain was used to ferment the compound grain material, and the fermented grain beverage process was optimized. The antioxidant activity of the fermented grain beverage is greatly improved compared with that before fermentation, and the fermented grain beverage has a significant effect on lowering cholesterol and can well control the body weight of mice. The fermented grain beverage finally produced is a live bacteria fermented grain beverage with rich nutritional value, anti-oxidation, weight loss and cholesterol-lowering activities, sweet and sour, and delicious.

Description

technical field [0001] The invention belongs to the technical field of probiotic fermented grain beverages, and in particular relates to a probiotic with high anti-oxidation and cholesterol-lowering activities based on sour porridge and the fermented grain beverage. Background technique [0002] Cholesterol is one of the important nutritional elements for the human body. It is closely related to the formation of cholic acid, the construction of cell membranes and the synthesis of hormones. Excessive cholesterol levels in serum are an important cause of atherosclerosis and cardiovascular diseases. At present, nearly 1 / 3 of adults in my country have high blood lipids, and hyperlipidemia has now become the first invisible killer affecting human health. [0003] Probiotics are widely used in the food industry. Probiotics can regulate the intestinal environment of the human body through the bacteria themselves and their metabolites, so as to achieve the beneficial effect of main...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/20A23L2/38A23L33/135C12R1/25
CPCA23L2/382A23L33/135A23V2002/00C12R2001/25C12N1/205A23V2400/169A23V2200/30A23V2200/3262
Inventor罗学刚蒋雅馨董青青周秦王蕾周浩张同存
OwnerTIANJIN UNIV OF SCI & TECH