Gene for controlling rape plant type, molecular marker and application thereof

A technology of molecular markers and genes, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems such as unclear application prospects

Active Publication Date: 2018-07-03
HUAZHONG AGRI UNIV
View PDF2 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, no germplasm resources related to Aux / IAA gene mutations have been reported in rapeseed, and the application prospect of this gene family in rapeseed plant improvement is still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene for controlling rape plant type, molecular marker and application thereof
  • Gene for controlling rape plant type, molecular marker and application thereof
  • Gene for controlling rape plant type, molecular marker and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Example 1: Phenotype identification of Brassica napus mutant ds-5

[0064] (1) The wild type of Brassica napus (remarks in this manual: the "wild type" mentioned in the present invention refers to non-transgenic material refers to the original variety) ds-5 seeds and the Brassica napus mutant ds-5 The seeds (preservation number is CCTCC NO: P201721) were soaked in 70% alcohol for 1 minute, then sterilized in 50% sodium hypochlorite solution for 15 minutes, and finally washed 3 times with sterile water. Sow the treated seeds in a box filled with MS medium (MS+1% agar gel), and observe the length of the hypocotyl after cultivating for one week at 24°C (16h light / 8h dark), the results are as follows: figure 2 As shown in panel A in the figure: the hypocotyl of the mutant is dark green and obviously shortened.

[0065] (2) The wild-type ds-5 and mutant ds-5 were planted in the experimental field of Huazhong Agricultural University, and the phenotypes of the two were obser...

Embodiment 2

[0067] Embodiment 2: Map-position cloning of DS5 gene

[0068] (1) F 1 generation. f 1 F 2 generation segregation population, and simultaneously crossed with ds-5 to obtain BC 1 Separate groups. Subsequently, for F 2 Generations and BC 1 Each individual plant of the generation was bagged and selfed to obtain F 2:3 and BC 1:2 family lineage. The two parents and F1, F 2 and BC 1 segregating populations and F 2:3 and BC 1:2 The families were planted in the experimental field of Huazhong Agricultural University, and the plant height was investigated and measured at the mature stage. The result is as image 3 Shown, F 1 The plant height of the generation was between the parents and had a significant difference (P2 The plant height of a single plant in the population is between 40cm-231cm and presents a trimodal distribution; F 2:3 The plant height test of the offspring showed that F 2 The population consisted of 69 homozygous short stems, 157 heterozygous intermedi...

Embodiment 3

[0076] Example 3: Development and detection of allele-specific markers

[0077] (1) For the SNP located in the second exon (G>A), use dCAPS Finder 2.0 (http: / / helix.wustl.edu / dcaps / ) to design an allele-specific primer AS_dCPAS, whose sequence is AS_dCPAS-F:TTAAGCATATCCATAACTTTGAAATTAAAT, AS_dCPAS-R:GAGTCATCATGTTCTTCCTGTAGTTCCTCACAGGTGGGAAT( Figure 6 in A panel).

[0078] (2) The detection method of AS_dCPAS marker is as follows: firstly carry out PCR reaction, 20μl PCR system includes: 75ngDNA template, 2μl 10×Taq buffer, 1.6μl MgCl 2 (25mM), 0.4μl dNTPs (10mM), 2μl PCRprimers (1μl each of forward and reverse primers, the concentration is 10μM each) and 5U Taq DNApolymerase (recombinat, Fermentas), supplemented with ddH 2 0 to 20 μl. Reaction program: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 sec, renaturation at 65°C for 30 sec, extension at 72°C for 40 sec, a total of 40 cycles; extension at 72°C for 5 min, storage at 4°C. Then carry out enzyme di...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of rapeseed genetic engineering and relates to a gene for controlling a rape plant type, a molecular marker and an application thereof. The gene for controlling a rape plant type can control plant height, branching angles and leaf morphology. Through map-based cloning and genetic transformation, a gene BnaA3. IAA7 for controlling a rape plant type is cloned and verified. The gene is located on an A3 chromosome of a rape genome, codes an auxin protein and has a sequence shown in the formula of SEQ ID NO: 1. The invention also discloses a separated mutant geneBnaA3. Iaa7 of the gene BnaA3. IAA7. The mutant gene has a sequence shown in the formula of SEQ ID NO: 4 and can significantly reduce the plant height and branching angles of rape. The mutant gene does not influence the yield per plant when improving the rape variety or the inbred plant type, and increases the yield per plant when improving the rape hybrid plant type. The invention also disclosesa related molecular marker.

Description

technical field [0001] The invention belongs to the technical field of rapeseed genetic engineering, and specifically relates to a gene for controlling rapeseed plant type, a molecular marker and an application thereof. The genes controlling the rapeseed plant type include controlling plant height, branch angle and leaf shape. The gene BnaA3.IAA7 (original number DS5) described in the present invention is located on the A3 chromosome of rapeseed, and the gene controls important plant type-related traits such as plant height, branch angle and leaf shape of rapeseed. The invention discloses the map-based cloning, function verification and application prospect of the DS5 gene in the improvement of rapeseed plant type, and also relates to the development and application of molecular markers based on the mutation site of the gene. Background technique [0002] Rapeseed is one of the main oil crops in my country. The perennial planting area of ​​rapeseed in my country is about 10...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82C12Q1/6895C12N15/11
CPCC07K14/415C12N15/8294C12Q1/6895C12Q2600/13C12Q2600/156
Inventor刘克德李海涛李娟娟宋居荣赵波
OwnerHUAZHONG AGRI UNIV