A method for detecting estradiol in food
An estradiol and food technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as no substantial breakthroughs, and achieve the advantages of avoiding false positive readings, simple operation, and improving accuracy. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0023] (1-a) Preparation of the recognition probe solution A: mix the aptamer solution and the hairpin chain solution in sodium dihydrogen phosphate buffer solution, the concentration of the aptamer solution is 5-50 μM, and the hairpin chain solution The concentration of the sodium dihydrogen phosphate solution is 1-5 μM, the concentration of the sodium dihydrogen phosphate solution is 0.01-1 M, the reaction is prepared to obtain the identification probe solution A, the reaction temperature is 15-45 ° C, and the reaction time is 5-45 minutes;
[0024] (1-b) Preparation of 8 groups of estradiol standard solution: the estradiol standard solution is dissolved in a mixed solution with a concentration of 1% to 10% methanol solution and a concentration of 0.01 to 1 μM sodium dihydrogen phosphate buffer solution to obtain Estradiol standard solution, the volume ratio of methanol solution and sodium dihydrogen phosphate buffer solution is 1:10, in the 8 groups of estradiol standard sol...
Embodiment 1
[0065] (1) Drawing of estradiol standard curve: comprising steps (1-a), (1-b), (1-c), (1-d) and (1-e),
[0066] (1-a) Preparation of recognition probe solution A:
[0067] The specific operation is as follows: first, keep the hairpin chain solution in a water bath at 95° C. for 10 minutes, and then cool it down to room temperature for 2 hours.
[0068] Mix 5 μL aptamer solution and 5 μL hairpin chain solution, and incubate in 20 μL disodium hydrogen phosphate buffer to form recognition probe solution A, the reaction temperature is 37°C, and the reaction time is 15 minutes.
[0069] The concentration of the aptamer solution is 10 μM, the concentration of the hairpin chain solution is 2.5 μM, and the concentration of the sodium dihydrogen phosphate solution is 0.1M.
[0070] The sequence composition of the estradiol aptamer is: TGGGCCCTTTACGGACCGCGTGATGGTT; the sequence composition of the hairpin chain is: AACCATCACGCGGTCCGTAACGATGGACTCGGCATCGAGTCCATCGTTAC.
[0071] (1-b) Prep...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More